CTDSP1 (NM_001206878) Human Untagged Clone

CAT#: SC329848

CTDSP1 (untagged) - Homo sapiens CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), transcript variant 3



  "NM_001206878" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CTDSP1 mouse monoclonal antibody, clone OTI1B6 (formerly 1B6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NIF3; NLI-IF; NLIIF; SCP1
Vector pCMV6-Entry
Sequence Data
>SC329848 representing NM_001206878.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGCCGCCCCGTGGGCTACCCAGGAGCAGGAGGAGGGCCGAGGGATCCAGCCCGGGGACCGGGGT
GACCAGAAGTCAGCAGCTTCCCAGAAGCCCCGAAGCCGGGGCATCCTCCACTCACTCTTCTGCTGTGTC
TGCCGGGATGATGGGGAGGCCCTGCCTGCTCACAGCGGGGCGCCCCTGCTTGTGGAGGAGAATGGCGCC
ATCCCTAAGACCCCAGTCCAATACCTGCTCCCTGAGGCCAAGGCCCAGGACTCAGACAAGATCTGCGTG
GTCATCGACCTGGACGAGACCCTGGTGCACAGCTCCTTCAAGCCAGTGAACAACGCGGACTTCATCATC
CCTGTGGAGATTGATGGGGTGGTCCACCAGGTCTACGTGTTGAAGCGTCCTCACGTGGATGAGTTCCTG
CAGCGAATGGGCGAGCTCTTTGAATGTGTGCTGTTCACTGCTAGCCTCGCCAAGTACGCAGACCCAGTA
GCTGACCTGCTGGACAAATGGGGGGCCTTCCGGGCCCGGCTGTTTCGAGAGTCCTGCGTCTTCCACCGG
GGGAACTACGTGAAGGACCTGAGCCGGTTGGGTCGAGACCTGCGGCGGGTGCTCATCCTGGACAATTCA
CCTGCCTCCTATGTCTTCCATCCAGACAATGCTGTACCGGTGGCCTCGTGGTTTGACAACATGAGTGAC
ACAGAGCTCCACGACCTCCTCCCCTTCTTCGAGCAACTCAGCCGTGTGGACGACGTGTACTCAGTGCTC
AGGCAGCCACGGCCAGGGAGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206878
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206878.1
RefSeq Size 2391 bp
RefSeq ORF 783 bp
Locus ID 58190
UniProt ID Q9GZU7
Protein Families Phosphatase
MW 29.1 kDa
Gene Summary This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) differs in the 5' UTR and has multiple differences in the coding region, including the use of an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...