METTL23 (NM_001206985) Human Untagged Clone

CAT#: SC329873

METTL23 (untagged) - Homo sapiens methyltransferase like 23 (METTL23), transcript variant 4



  "NM_001206985" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C17orf95; MRT44
Vector pCMV6-Entry
Sequence Data
>SC329873 representing NM_001206985.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATAACCTGCCACATCTGCAGGTGGTAGGACTAACATGGGGTCATATATCTTGGGATCTTCTGGCT
CTACCACCACAAGATATTATCCTTGCATCTGATGTGTTCTTTGAACCAGAAGATTTTGAAGACATTTTG
GCTACAATATATTTTTTGATGCACAAGAATCCCAAGGTCCAATTGTGGTCTACTTATCAAGTTAGGAGT
GCTGACTGGTCACTTGAAGCTTTACTCTACAAATGGGATATGAAATGTGTCCACATTCCTCTTGAGTCT
TTTGATGCAGACAAAGAAGATATAGCAGAATCTACCCTTCCAGGAAGACATACAGTTGAAATGCTGGTC
ATTTCCTTTGCAAAGGACAGTCTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206985
Insert Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206985.1
RefSeq Size 1047 bp
RefSeq ORF 372 bp
Locus ID 124512
UniProt ID Q86XA0
MW 14.2 kDa
Gene Summary The protein encoded by this gene functions as a transcription factor regulator in the transcriptional pathway for human cognition. It is a partner of the alpha subunit of the GA-binding protein transcription factor. Mutations in this gene cause mild autosomal recessive intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (4) lacks an alternate exon containing a portion of the 5' UTR and 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Variants 4, 5, 6 and 9 all encode isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...