CXADR (NM_001207065) Human Untagged Clone
CAT#: SC329903
CXADR (untagged) - Homo sapiens coxsackie virus and adenovirus receptor (CXADR), transcript variant 4
CNY 2,950.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAR; CAR4/6; HCAR |
Vector | pCMV6-Entry |
Sequence Data |
>SC329903 representing NM_001207065.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGCTCCTGCTGTGCTTCGTGCTCCTGTGCGGAGTAGTGGATTTCGCCAGAAGTTTGAGTATCACT ACTCCTGAAGAGATGATTGAAAAAGCCAAAGGGGAAACTGCCTATCTGCCATGCAAATTTACGCTTAGT CCCGAAGACCAGGGACCGCTGGACATCGAGTGGCTGATATCACCAGCTGATAATCAGAAGGTGGATCAA GTGGGAAGATGTGCCACCTCCAAAGAGCCGTACGTCCACTGCCAGAAGCTACATCGGCAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207065 |
Insert Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001207065.1 |
RefSeq Size | 5121 bp |
RefSeq ORF | 270 bp |
Locus ID | 1525 |
UniProt ID | P78310 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transmembrane |
Protein Pathways | Viral myocarditis |
MW | 10 kDa |
Gene Summary | The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21. [provided by RefSeq, May 2011] Transcript Variant: This variant (4, alternatively referred to as delta or CAR2/7) lacks four consecutive alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (4) has a shorter and distinct C-terminus compared to isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...