CDHH (CDH13) (NM_001220491) Human Untagged Clone

CAT#: SC329911

CDH13 (untagged) - Homo sapiens cadherin 13 (CDH13), transcript variant 5



  "NM_001220491" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CDH13 (H Cadherin) mouse monoclonal antibody, clone OTI3H6 (formerly 3H6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDHH; P105
Vector pCMV6-Entry
Sequence Data
>SC329911 representing NM_001220491.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGCCGAGAACTCCGCTCGTTCTGTGCGTTCTCCTGTCCCAGGTGCTGCTGCTAACATCTGCAGAA
GATTTGGACTGCACTCCTGGATTTCAGCAGAAAGTGTTCCATATCAATCAGCCAGCTGAATTCATTGAG
GACCAGTCAATTCTAAACTTGACCTTCAGTGACTGTAAGGGAAACGACAAGCTACGCTATGAGGTCTCG
AGCCCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAA
ACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAA
GACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGG
TCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAG
AGAACCCACAATCCTATTAACAGCGAACTTCTCTTGAATGAAGGCATTACAGCAGATTTAAATCCATGC
ATTACAATTTTAGCAATTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001220491
Insert Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001220491.1
RefSeq Size 955 bp
RefSeq ORF 573 bp
Locus ID 1012
UniProt ID P55290
MW 21.1 kDa
Gene Summary This gene encodes a member of the cadherin superfamily. The encoded protein is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. The protein lacks the cytoplasmic domain characteristic of other cadherins, and so is not thought to be a cell-cell adhesion glycoprotein. This protein acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. The gene is hypermethylated in many types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]
Transcript Variant: This variant (5) lacks several coding exons and uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 5, which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...