TREM1 (NM_001242589) Human Untagged Clone
CAT#: SC329988
TREM1 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD354; TREM-1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329988 representing NM_001242589.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGGAAGACCAGGCTCTGGGGGCTGCTGTGGATGCTCTTTGTCTCAGAACTCCGAGCTGCAACTAAA TTAACTGAGGAAAAGTATGAACTGAAAGAGGGGCAGACCCTGGATGTGAAATGTGACTACACGCTAGAG AAGTTTGCCAGCAGCCAGAAAGCTTGGCAGATAATAAGGGACGGAGAGATGCCCAAGACCCTGGCATGC ACAGAGAGGCCTTCAAAGAATTCCCATCCAGTCCAAGTGGGGAGGATCATACTAGAAGACTACCATGAT CATGGTTTACTGCGCGTCCGAATGGTCAACCTTCAAGTGGAAGATTCTGGACTGTATCAGTGTGTGATC TACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCA GGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCC TTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCC ACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGTATAGTTTCCAGGTCCCTGGG CCCCTGGTTTGGACACTGAGCCCTTTGTTTCCCAGTCTGTGTGCTGAGAGGATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242589 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242589.1 |
RefSeq Size | 2102 bp |
RefSeq ORF | 678 bp |
Locus ID | 54210 |
UniProt ID | Q9NP99 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 25.6 kDa |
Gene Summary | This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011] Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus, lacking the transmembrane domain, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232197 | TREM1 (Myc-DDK tagged) - Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), transcript variant 2 |
CNY 3,990.00 |
|
RG232197 | TREM1 (tGFP-tagged) - Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), transcript variant 2 |
CNY 4,370.00 |