PRMT2 (NM_001242864) Human Untagged Clone

CAT#: SC330036

PRMT2 (untagged) - Homo sapiens protein arginine methyltransferase 2 (PRMT2), transcript variant 3



  "NM_001242864" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PRMT2 mouse monoclonal antibody, clone OTI3A3 (formerly 3A3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HRMT1L1
Vector pCMV6-Entry
Sequence Data
>SC330036 representing NM_001242864.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAACATCAGGTGACTGTCCCAGAAGTGAATCGCAGGGAGAAGAGCCTGCTGAGTGCAGTGAGGCC
GGTCTCCTGCAGGAGGGAGTACAGCCAGAGGAGTTTGTGGCCATCGCGGACTACGCTGCCACCGATGAG
ACCCAGCTCAGTTTTTTGAGAGGAGAAAAAATTCTTATCCTGAGACAAACCACTGCAGATTGGTGGTGG
GGTGAGCGTGCGGGCTGCTGTGGGTACATTCCGGCAAACCATGTGGGGAAGCACGTGGATGAGTACGAC
CCCGAGGACACGTGGCAGGATGAAGAGTACTTCGGCAGCTATGGAACTCTGAAACTCCACTTGGAGATG
TTGGCAGACCAGCCACGAACAACTAAATACCACAGTGTCATCCTGCAGAATAAAGAATCCCTGACGGAT
AAAGTCATCCTGGACGTGGGCTGTGGGACTGGGATCATCAGTCTCTTCTGTGCACACTATGCGCGGCCT
AGAGCGGTGTACGCGGTGGAGGCCAGTGAGATGGCACAGCACACGGGGCAGCTGGTCCTGCAGAACGGC
TTTGCTGACATCATCACCGTGTACCAGCAGAAGGTGGAGGATGTGGTGCTGCCCGAGAAGGTGGACGTG
CTGGTGTCTGAGTGGATGGGGACCTGCCTGCTGACCCTGAGGGGCGAGCTGCGCTTCGACATCAGGAAG
GCGGGGACCCTGCACGGCTTCACGGCCTGGTTTAGCGTCCACTTCCAGAGCCTGCAGGAGGGGCAGCCG
CCGCAGGTGCTCAGCACCGGGCCCTTCCACCCCACCACACACTGGAAGCAGACGCTGTTCATGATGGAC
GACCCAGTCCCTGTCCATACAGGAGACGTGGTCACGGGTTCAGTTGTGTTGCAGAGAAACCCAGTGTGG
AGAAGGCACATGTCTGTGGCTCTGAGCTGGGCTGTCACTTCCAGACAAGACCCCACATCTCAAAAAGTT
GGAGAAAAAGTCTTCCCCATCTGGAGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001242864
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242864.2
RefSeq Size 2031 bp
RefSeq ORF 996 bp
Locus ID 3275
UniProt ID P55345
Protein Families Druggable Genome
MW 37.2 kDa
Gene Summary Arginine methyltransferase that methylates the guanidino nitrogens of arginyl residues in proteins such as STAT3, FBL, histone H4. Acts as a coactivator (with NCOA2) of the androgen receptor (AR)-mediated transactivation. Acts as a coactivator (with estrogen) of estrogen receptor (ER)-mediated transactivation. Enhances PGR, PPARG, RARA-mediated transactivation. May inhibit NF-kappa-B transcription and promote apoptosis. Represses E2F1 transcriptional activity (in a RB1-dependent manner). May be involved in growth regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks 2 consecutive exons in the 3' coding region compared to variant 1. However, it maintains the reading frame and encodes a shorter isoform (2) lacking an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...