ELF5 (NM_001243080) Human Untagged Clone
CAT#: SC330078
ELF5 (untagged) - Homo sapiens E74-like factor 5 (ets domain transcription factor) (ELF5), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ESE2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330078 representing NM_001243080.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTGGACTCGGTGACACACAGCACCTTCCTGCCTAATGCATCCTTCTGCGATCCCCTGATGTCGTGG ACTGATCTGTTCAGCAATGAAGAGTACTACCCTGCCTTTGAGCATCAGACAGATGCTGATTCCAACTGC TTGAAAACAAGTGGCATCAAAAGTCAAGACTGTCACAGTCATAGTAGAACAAGCCTCCAAAGTTCTCAT CTATGGGAATTTGTACGAGACCTGCTTCTATCTCCTGAAGAAAACTGTGGCATTCTGGAATGGGAAGAT AGGGAACAAGGAATTTTTCGGGTGGTTAAATCGGAAGCCCTGGCAAAGATGTGGGGACAAAGGAAGAAA AATGACAGAATGACATATGAAAAGTTGAGCAGAGCCCTGAGATACTACTATAAAACAGGAATTTTGGAG CGGGTTGACCGAAGGTTAGTGTACAAATTTGGAAAAAATGCACACGGGTGGCAGGAAGACAAGCTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243080 |
Insert Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243080.1 |
RefSeq Size | 2039 bp |
RefSeq ORF | 483 bp |
Locus ID | 2001 |
UniProt ID | Q9UKW6 |
Protein Families | Transcription Factors |
MW | 18.9 kDa |
Gene Summary | The protein encoded by this gene is a member of an epithelium-specific subclass of the Ets transcritpion factor family. In addition to its role in regulating the later stages of terminal differentiation of keratinocytes, it appears to regulate a number of epithelium-specific genes found in tissues containing glandular epithelium such as salivary gland and prostate. It has very low affinity to DNA due to its negative regulatory domain at the amino terminus. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks two alternate in-frame exons compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231905 | ELF5 (Myc-DDK tagged) - Homo sapiens E74-like factor 5 (ets domain transcription factor) (ELF5), transcript variant 3 |
CNY 3,990.00 |
|
RG231905 | ELF5 (tGFP-tagged) - Homo sapiens E74-like factor 5 (ets domain transcription factor) (ELF5), transcript variant 3 |
CNY 2,920.00 |