PELI3 (NM_001243136) Human Untagged Clone

CAT#: SC330088

PELI3 (untagged) - Homo sapiens pellino E3 ubiquitin protein ligase family member 3 (PELI3), transcript variant 4



  "NM_001243136" in other vectors (2)

CNY 3,520.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PELI3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330088 representing NM_001243136.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCACCACATCTCCACGCCGCTCGTCTCCAAGGCACTGAGTAACCGTGGTCAGCACAGCATCTCGTAT
ACACTGTCCCGGAGCCACTCGGTCATAGTGGAGTATACACATGATAGCGACACAGACATGTTCCAGATT
GGCCGCTCCACAGAGAACATGATTGACTTCGTGGTAACAGACACGTCCCCTGGAGGAGGGGCTGCCGAG
GGCCCTTCTGCCCAGAGCACCATCTCCCGCTATGCCTGCCGCATCCTCTGTGACCGCCGGCCACCCTAT
ACTGCCCGCATCTATGCCGCTGGCTTCGATGCCTCTAGCAACATCTTCCTTGGAGAGCGAGCGGCCAAA
TGGCGGACCCCAGATGGCCTGATGGATGGACTGACCACCAATGGAGTCCTGGTGATGCACCCGGCAGGC
GGCTTCTCCGAGGACTCAGCCCCGGGTGTCTGGCGGGAGATCTCGGTCTGTGGGAATGTGTACACATTG
CGGGACAGCCGCTCAGCCCAGCAGCGGGGCAAGCTGGTGGAAAACGAGTCCAACGTGCTGCAGGACGGC
TCTCTCATCGACCTGTGTGGGGCCACACTGCTGTGGCGCACACCGGCGGGGCTGCTGCGGGCTCCCACA
CTGAAGCAACTGGAGGCCCAGCGGCAGGAGGCAAATGCAGCGCGGCCCCAGTGCCCCGTGGGCCTCAGC
ACTCTGGCCTTCCCCAGCCCAGCCCGTGGCCGCACAGCGCCCGACAAACAGCAGCCCTGGGTCTACGTC
CGCTGCGGGCACGTCCATGGCTACCACGGCTGGGGCTGCCGGCGGGAGCGGGGCCCCCAGGAGCGCGAA
TGTCCTCTCTGCCGCCTTGTGGGGCCTTATGTGCCTCTATGGCTTGGCCAGGAGGCCGGCCTCTGCCTG
GACCCTGGGCCGCCTAGCCATGCCTTTGCACCTTGCGGCCACGTCTGCTCTGAGAAGACTGCCCGCTAC
TGGGCCCAGACACCACTGCCCCACGGCACCCATGCTTTCCATGCCGCCTGCCCCTTTTGCGGGGCCTGG
CTTACCGGCGAGCATGGCTGCGTCCGCCTCATTTTCCAGGGCCCGCTGGATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001243136
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243136.1
RefSeq Size 2538 bp
RefSeq ORF 1089 bp
Locus ID 246330
UniProt ID Q8N2H9
MW 39.4 kDa
Gene Summary The protein encoded by this gene is a scaffold protein and an intermediate signaling protein in the innate immune response pathway. The encoded protein helps transmit the immune response signal from Toll-like receptors to IRAK1/TRAF6 complexes. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...