CD166 (ALCAM) (NM_001243283) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CD166; MEMD
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330113 representing NM_001243283. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAATCCAAGGGGGCCAGTTCCTGCCGTCTGCTCTTCTGCCTCTTGATCTCCGCCACCGTCTTCAGG CCAGGCCTTGGATGGTATACTGTAAATTCAGCATATGGAGATACCATTATCATACCTTGCCGACTTGAC GTACCTCAGAATCTCATGTTTGGCAAATGGAAATATGAAAAGCCCGATGGCTCCCCAGTATTTATTGCC TTCAGATCCTCTACAAAGAAAAGTGTGCAGTACGACGATGTACCAGAATACAAAGACAGATTGAACCTC TCAGAAAACTACACTTTGTCTATCAGTAATGCAAGGATCAGTGATGAAAAGAGATTTGTGTGCATGCTA GTAACTGAGGACAACGTGTTTGAGGCACCTACAATAGTCAAGGTGTTCAGTAAGTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001243283
Insert Size	402 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001243283.1
RefSeq Size	2075 bp
RefSeq ORF	402 bp
Locus ID	214
UniProt ID	Q13740
Protein Families	Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways	Cell adhesion molecules (CAMs)
MW	15.1 kDa
Gene Summary	This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (4) lacks multiple 3' exons, and has an alternate 3' sequence, compared to variant 1. The resulting isoform (4) is the shortest; it is truncated at the C-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.