ULBP4 (RAET1E) (NM_001243327) Human Untagged Clone

CAT#: SC330116

RAET1E (untagged) - Homo sapiens retinoic acid early transcript 1E (RAET1E), transcript variant 3



  "NM_001243327" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RAET1E Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA350J20.7; LETAL; N2DL-4; NKG2DL4; RAET1E2; RL-4; ULBP4
Vector pCMV6-Entry
Sequence Data
>SC330116 representing NM_001243327.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGAAGAATATCCCTGACTTCTAGCCCTGTGCGCCTTCTTTTGTTTCTGCTGTTGCTACTAATAGCC
TTGGAGATCATGGTTGGTGGTCACTCTCTTTGCTTCAACTTCACTATAAAATCATTGTCCAGACCTGGA
CAGCCCTGGTGTGAAGCGCAGGTCTTCTTGAATAAAAATCTTTTCCTTCAGTACAACAGTGACAACAAC
ATGGTCAAACCTCTGGGCCTCCTGGGGAAGAAGGTATATGCCACCAGCACTTGGGGAGAATTGACCCAA
ACGCTGGGAGAAGTGGGGCGAGACCTCAGGATGCTCCTTTGTGACATCAAACCCCAGATAAAGACCAGT
GATCCTTCCACTCTGCAAGTCGAGATGTTTTGTCAACGTGAAGCAGAACGGTGCACTGGTGCATCCTGG
CAGTTCGCCACCAATGGAGAGAAATCCCTCCTCTTTGACGCAATGAACATGACCTGGACAGTAATTAAT
CATGAAGCCAGTAAGATCAAGGAGACATGGAAGAAAGACAGAGGGCTGGAAAAGTATTTCAGGAAGCTC
TCAAAGGGAGACTGCGATCACTGGCTCAGGGAATTCTTAGGGCACTGGGAGGCAATGCCAGAACCGACA
GGTAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243327
Insert Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243327.1
RefSeq Size 1032 bp
RefSeq ORF 630 bp
Locus ID 135250
UniProt ID Q8TD07
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
MW 24 kDa
Gene Summary This gene belong to the RAET1 family, which consists of major histocompatibility complex (MHC) class I-related genes located in a cluster on chromosome 6q24.2-q25.3. This and RAET1G protein differ from other RAET1 proteins in that they have type I membrane-spanning sequences at their C termini rather than glycosylphosphatidylinositol anchor sequences. This protein functions as a ligand for NKG2D receptor, which is expressed on the surface of several types of immune cells, and is involved in innate and adaptive immune responses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs at the 3' end compared to variant 1. This results in a frame-shift and a shorter isoform (3) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...