Estrogen Related Receptor gamma (ESRRG) (NM_001243515) Human Untagged Clone

CAT#: SC330137

ESRRG (untagged) - Homo sapiens estrogen-related receptor gamma (ESRRG), transcript variant 15



  "NM_001243515" in other vectors (2)

CNY 4,090.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ESRRG (Estrogen Related Receptor gamma) mouse monoclonal antibody, clone OTI1E5 (formerly 1E5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ERR-gamma; ERR3; ERRg; ERRgamma; NR3B3
Vector pCMV6-Entry
Sequence Data
>SC330137 representing NM_001243515.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCAAACAAAGATCGACACATTGATTCCAGCTGTTCGTCCTTCATCAAGACGGAACCTTCCAGCCCA
GCCTCCCTGACGGACAGCGTCAACCACCACAGCCCTGGTGGCTCTTCAGACGCCAGTGGGAGCTACAGT
TCAACCATGAATGGCCATCAGAACGGACTTGACTCGCCACCTCTCTACCCTTCTGCTCCTATCCTGGGA
GGTAGTGGGCCTGTCAGGAAACTGTATGATGACTGCTCCAGCACCATTGTTGAAGATCCCCAGACCAAG
TGTGAATACATGCTCAACTCGATGCCCAAGAGACTGTGTTTAGTGTGTGGTGACATCGCTTCTGGGTAC
CACTATGGGGTAGCATCATGTGAAGCCTGCAAGGCATTCTTCAAGAGGACAATTCAAGGCAATATAGAA
TACAGCTGCCCTGCCACGAATGAATGTGAAATCACAAAGCGCAGACGTAAATCCTGCCAGGCTTGCCGC
TTCATGAAGTGTTTAAAAGTGGGCATGCTGAAAGAAGGGGTGCGTCTTGACAGAGTACGTGGAGGTCGG
CAGAAGTACAAGCGCAGGATAGATGCGGAGAACAGCCCATACCTGAACCCTCAGCTGGTTCAGCCAGCC
AAAAAGCCATATAACAAGATTGTCTCACATTTGTTGGTGGCTGAACCGGAGAAGATCTATGCCATGCCT
GACCCTACTGTCCCCGACAGTGACATCAAAGCCCTCACTACACTGTGTGACTTGGCCGACCGAGAGTTG
GTGGTTATCATTGGATGGGCGAAGCATATTCCAGGCTTCTCCACGCTGTCCCTGGCGGACCAGATGAGC
CTTCTGCAGAGTGCTTGGATGGAAATTTTGATCCTTGGTGTCGTATACCGGTCTCTTTCGTTTGAGGAT
GAACTTGTCTATGCAGACGATTATATAATGGACGAAGACCAGTCCAAATTAGCAGGCCTTCTTGATCTA
AATAATGCTATCCTGCAGCTGGTAAAGAAATACAAGAGCATGAAGCTGGAAAAAGAAGAATTTGTCACC
CTCAAAGCTATAGCTCTTGCTAATTCAGACTCCATGCACATAGAAGATGTTGAAGCCGTTCAGAAGCTT
CAGGATGTCTTACATGAAGCGCTGCAGGATTATGAAGCTGGCCAGCACATGGAAGACCCTCGTCGAGCT
GGCAAGATGCTGATGACACTGCCACTCCTGAGGCAGACCTCTACCAAGGCCGTGCAGCATTTCTACAAC
ATCAAACTAGAAGGCAAAGTCCCAATGCACAAACTTTTTTTGGAAATGTTGGAGGCCAAGGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243515
Insert Size 1308 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243515.1
RefSeq Size 5555 bp
RefSeq ORF 1308 bp
Locus ID 2104
UniProt ID P62508
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
MW 48.6 kDa
Gene Summary This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (15) has two additional exons in the 5' region and uses a downstream AUG start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, compared to isoform 1. Variants 2-4, 9-15, and 17-21 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Estrogen Related Receptor gamma产品

Customer Reviews 
Loading...