Cofilin 2 (CFL2) (NM_001243645) Human Untagged Clone

CAT#: SC330154

CFL2 (untagged) - Homo sapiens cofilin 2 (muscle) (CFL2), transcript variant 5



  "NM_001243645" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CFL2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NEM7
Vector pCMV6-Entry
Sequence Data
>SC330154 representing NM_001243645.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAGTAAGGAAATCTTCTACACAAGAGGAGATCAAAAAGAGAAAGAAAGCAGTTCTCTTCTGTTTA
AGCGATGACAAAAGACAAATAATTGTAGAGGAAGCAAAGCAGATCTTGGTGGGTGACATTGGTGATACT
GTAGAGGACCCCTACACATCTTTTGTGAAGTTGCTACCTCTGAATGATTGCCGATATGCTTTGTACGAT
GCCACATACGAAACAAAAGAGTCTAAGAAAGAAGACCTAGTATTTATATTCTGGGCTCCTGAAAGTGCA
CCTTTAAAAAGCAAGATGATTTATGCTAGCTCTAAAGATGCCATTAAAAAGAAATTTACAGGTATTAAA
CATGAGTGGCAAGTAAATGGCTTGGATGATATTAAGGACCGTTCGACACTTGGAGAGAAATTGGGAGGC
AATGTAGTAGTTTCACTTGAAGGAAAACCATTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001243645
Insert Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243645.1
RefSeq Size 3102 bp
RefSeq ORF 450 bp
Locus ID 1073
UniProt ID Q9Y281
Protein Families Druggable Genome
Protein Pathways Axon guidance, Fc gamma R-mediated phagocytosis, Regulation of actin cytoskeleton
MW 16.9 kDa
Gene Summary This gene encodes an intracellular protein that is involved in the regulation of actin-filament dynamics. This protein is a major component of intranuclear and cytoplasmic actin rods. It can bind G- and F-actin in a 1:1 ratio of cofilin to actin, and it reversibly controls actin polymerization and depolymerization in a pH-dependent manner. Mutations in this gene cause nemaline myopathy type 7, a form of congenital myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (5) differs in the 5' UTR and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...