CROT (NM_001243745) Human Untagged Clone

CAT#: SC330169

CROT (untagged) - Homo sapiens carnitine O-octanoyltransferase (CROT), transcript variant 3



  "NM_001243745" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CROT Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COT
Vector pCMV6-Entry
Sequence Data
>SC330169 representing NM_001243745.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAAATCAATTGGCTAAATCAACTGAAGAACGAACATTTCAGTACCAGGATTCTCTTCCATCACTG
CCTGTTCCTTCACTTGAAGAATCATTAAAAAAATACCTTGAATCAGTGAAACCATTTGCAAATCAAGAA
GAATATAAGAAAACTGAAGAAATAGTTCAAAAATTTCAAAGTGGGATTGGAGAAAAATTGCACCAGAAA
TTGCTTGAAAGAGCAAAAGGAAAAAGAAATTGGGTATTTGTTGTTATAATTGAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001243745
Insert Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243745.1
RefSeq Size 1264 bp
RefSeq ORF 264 bp
Locus ID 54677
UniProt ID Q9UKG9
Protein Families Druggable Genome
MW 10.2 kDa
Gene Summary This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Transcript Variant: This variant (3) includes an alternate segment and a distinct 3' UTR compared to variant 1. The encoded isoform (3) is significantly shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...