GNG2 (NM_001243773) Human Untagged Clone
CAT#: SC330179
GNG2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
Sequence Data |
>SC330179 representing NM_001243773.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCC AATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCAAG GAAGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGTTTTTCTGTGCC ATCCTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243773 |
Insert Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243773.1 |
RefSeq Size | 3899 bp |
RefSeq ORF | 216 bp |
Locus ID | 54331 |
UniProt ID | P59768 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway |
MW | 7.9 kDa |
Gene Summary | This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231538 | GNG2 (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2 |
CNY 1,200.00 |
|
RG231538 | GNG2 (tGFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2 |
CNY 4,370.00 |