PAMM (FAM213A) (NM_001243782) Human Untagged Clone

CAT#: SC330186

FAM213A (untagged) - Homo sapiens family with sequence similarity 213, member A (FAM213A), transcript variant 6



  "NM_001243782" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PRXL2A rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Adrx; C10orf58; FAM213A; PAMM
Vector pCMV6-Entry
Sequence Data
>SC330186 representing NM_001243782.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTG
GCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAG
GATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAAT
GGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCC
TCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACT
GAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGT
CCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCC
TGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGA
TCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCT
GTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001243782
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243782.1
RefSeq Size 1656 bp
RefSeq ORF 678 bp
Locus ID 84293
UniProt ID Q9BRX8
Protein Families Secreted Protein, Transmembrane
MW 25.3 kDa
Gene Summary Involved in redox regulation of the cell (PubMed:26438880, PubMed:19951071). Acts as an antioxidant (PubMed:19951071, PubMed:26438880). Inhibits TNFSF11-induced NFKB1 and JUN activation and osteoclast differentiation (PubMed:19951071). May affect bone resorption and help to maintain bone mass (PubMed:19951071). Acts as a negative regulator of macrophage-mediated inflammation by inhibiting macrophage production of inflammatory cytokines, probably through suppression of the MAPK signaling pathway (PubMed:26438880).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR, uses an alternate splice site and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...