Syntaxin 5A (STX5) (NM_001244666) Human Untagged Clone

CAT#: SC330217

STX5 (untagged) - Homo sapiens syntaxin 5 (STX5), transcript variant 2



  "NM_001244666" in other vectors (2)

CNY 3,140.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


STX5 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SED5; STX5A
Vector pCMV6-Entry
Sequence Data
>SC330217 representing NM_001244666.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATCCCGCGGAAACGCTACGGGTCTAAGAACACGGATCAGGGTGTCTACCTGGGTCTCTCAAAGACA
CAGGTCCTGTCCCCTGCAACTGCTGGCAGTAGCAGCAGCGACATCGCCCCTCTGCCCCCCCCAGTGACC
CTCGTCCCTCCCCCTCCCGACACCATGTCCTGCCGGGATCGGACCCAGGAGTTTCTGTCTGCCTGCAAG
TCGCTGCAGACCCGTCAGAATGGAATCCAGACAAATAAGCCAGCTTTGCGTGCTGTCCGACAACGCAGT
GAATTCACCCTCATGGCCAAGCGCATTGGGAAAGACCTTAGCAACACATTTGCCAAGCTGGAGAAGCTG
ACAATCTTGGCAAAGCGCAAGTCCCTCTTTGATGATAAAGCAGTGGAAATTGAAGAGCTAACATATATC
ATCAAACAGGACATCAATAGCCTCAACAAACAAATTGCTCAGCTCCAGGATTTCGTGAGAGCCAAGGGC
AGCCAGAGTGGCCGGCACCTGCAGACCCACTCCAACACCATTGTGGTCTCCTTGCAGTCGAAACTGGCT
TCTATGTCCAATGACTTCAAATCGGTTTTAGAAGTGAGGACAGAGAACCTGAAGCAGCAGAGGAGCCGG
AGAGAGCAGTTCTCCCGGGCACCTGTGTCAGCCCTGCCCCTTGCCCCTAACCACCTGGGCGGTGGTGCT
GTGGTTCTGGGGGCAGAGTCCCATGCCTCCAAGGATGTCGCCATCGACATGATGGACTCTCGGACCAGC
CAGCAGCTGCAGCTCATTGACGAGCAGGATTCCTACATCCAGAGTCGGGCAGACACCATGCAGAACATT
GAGTCGACAATTGTTGAGTTGGGCTCCATCTTTCAGCAGTTGGCACACATGGTTAAGGAACAGGAGGAA
ACCATTCAGAGTGTCCTTTTGTTTCCTCTTCTCCCGGCCTTGTCCCCAGGATCGACGAGAACGTGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001244666
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244666.1
RefSeq Size 1872 bp
RefSeq ORF 966 bp
Locus ID 6811
UniProt ID Q13190
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 35.5 kDa
Gene Summary This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift and early stop codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...