MOB4A (MOB1B) (NM_001244766) Human Untagged Clone

CAT#: SC330224

MOB1B (untagged) - Homo sapiens MOB kinase activator 1B (MOB1B), transcript variant 1



  "NM_001244766" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MOBKL1A (MOB4A) mouse monoclonal antibody, clone OTI1H2 (formerly 1H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MATS2; MOB4A; MOBKL1A
Vector pCMV6-Entry
Sequence Data
>SC330224 representing NM_001244766.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGGAGCTACTGATGTGAATGAAAGTGGTAGTCGCTCTTCTAAAACTTTTAAACCAAAGAAGAAC
ATTCCAGAGGGTTCTCACCAGTATGAGCTCTTAAAACACGCAGAAGCCACACTTGGCAGTGGCAACCTT
CGGATGGCTGTCATGCTTCCTGAAGGGGAAGATCTCAATGAATGGGTTGCAGTTAACACTGTGGATTTC
TTCAATCAGATCAACATGCTTTATGGAACTATCACAGACTTCTGTACAGAAGAGAGTTGTCCAGTGATG
TCAGCTGGCCCAAAATATGAGTATCATTGGGCAGATGGAACGAACATAAAGAAACCTATTAAGTGCTCT
GCACCAAAGTATATTGATTACTTGATGACTTGGGTTCAGGACCAGTTGGATGATGAGACGTTATTTCCA
TCAAAAATTGGTGTCCCGTTCCCAAAGAATTTCATGTCTGTGGCAAAAACTATACTCAAACGCCTCTTT
AGGGTTTATGCTCACATTTATCATCAGCATTTTGACCCTGTGATCCAGCTTCAGGAGGAAGCACATCTA
AATACATCTTTCAAGCACTTTATTTTTTTTGTCCAGGAATTCAACCTTATTGATAGAAGAGAACTTGCA
CCACTCCAAGAACTGATTGAAAAACTCACCTCAAAAGACAGATAA

Restriction Sites SgfI-MluI     
ACCN NM_001244766
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244766.1
RefSeq Size 7091 bp
RefSeq ORF 666 bp
Locus ID 92597
UniProt ID Q7L9L4
MW 25.5 kDa
Gene Summary The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...