MS4A6A (NM_001247999) Human Untagged Clone

CAT#: SC330240

MS4A6A (untagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 4



  "NM_001247999" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal MS4A6A Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 4SPAN3; 4SPAN3.2; CD20L3; CDA01; MS4A6; MST090; MSTP090
Vector pCMV6-Entry
Sequence Data
>SC330240 representing NM_001247999.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTTTTACTGAAGTTGCTAGAAGTTTACAGAAAAGGAAGTGCAGGAACATTTCACAAATCTACAATC
TTTGGCAACACCATCATGACATCACAACCTGTTCCCAATGAGACCATCATAGTGCTCCCATCAAATGTC
ATCAACTTCTCCCAAGCAGAGAAACCCGAACCCACCAACCAGGGGCAGGATAGCCTGAAGAAACATCTA
CACGCAGAAATCAAAGTTATTGGGACTATCCAGATCTTGTGTGGCATGATGGTATTGAGCTTGGGGATC
ATTTTGGCATCTGCTTCCTTCTCTCCAAATTTTACCCAAGTGACTTCTACACTGTTGAACTCTGCTTAC
CCATTCATAGGACCCTTTTTTTTTATCATCTCTGGCTCTCTATCAATCGCCACAGAGAAAAGGTTAACC
AAGCTTTTGGTGCATAGCAGCCTGGTTGGAAGCATTCTGAGTGCTCTGTCTGCCCTGGTGGGTTTCATT
ATCCTGTCTGTCAAACAGGCCACCTTAAATCCTGCCTCACTGCAGTGTGAGTTGGACAAAAATAATATA
CCAACAAGAAGTTATGTTTCTTACTTTTATCATGATTCACTTTATACCACGGACTGCTATACAGCCAAA
GCCAGTCTGGCTGGAACTCTCTCTCTGATGCTGATTTGCACTCTGCTGGAATTCTGCCTAGCTGTGCTC
ACTGCTGTGCTGCGGTGGAAACAGGCTTACTCTGACTTCCCTGGGGTGAGTGTGCTGGCCGGCTTCACT
TAA

Restriction Sites SgfI-MluI     
ACCN NM_001247999
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001247999.1
RefSeq Size 1751 bp
RefSeq ORF 762 bp
Locus ID 64231
UniProt ID Q9H2W1
Protein Families Druggable Genome, Transmembrane
MW 27.4 kDa
Gene Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...