CD83 (NM_001251901) Human Untagged Clone

CAT#: SC330244

CD83 (untagged) - Homo sapiens CD83 molecule (CD83), transcript variant 3



  "NM_001251901" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CD83 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BL11; HB15
Vector pCMV6-Entry
Sequence Data
>SC330244 representing NM_001251901.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGACACCCCAGGAAGACCACCTCAGGGGACAGCACTATCATCAGAAGGGGCAAAATGGTTCTTTC
GACGCCCCCAATGAAAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGCAACTCGGGGACATAC
AGGTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGCAAGGTGATCTTGAGAGTGACAGGA
TGCCCTGCACAGCGTAAAGAAGAGACTTTTAAGAAATACAGAGCGGAGATTGTCCTGCTGCTGGCTCTG
GTTATTTTCTACTTAACACTCATCATTTTCACTTGTAAGTTTGCACGGCTACAGAGTATCTTCCCAGAT
TTTTCTAAAGCTGGCATGGAACGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTG
ACTCCTCACAAGACAGAACTGGTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001251901
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001251901.1
RefSeq Size 2307 bp
RefSeq ORF 441 bp
Locus ID 9308
UniProt ID Q01151
Protein Families Transmembrane
MW 16.6 kDa
Gene Summary The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (c) has a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...