SLC39A9 (NM_001252152) Human Untagged Clone

CAT#: SC330275

SLC39A9 (untagged) - Homo sapiens solute carrier family 39, member 9 (SLC39A9), transcript variant 5



  "NM_001252152" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal ZIP9 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ZIP-9; ZIP9
Vector pCMV6-Entry
Sequence Data
>SC330275 representing NM_001252152.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTGCTGGTGGACCAGATTGGTAACTCCCATGTGCATTCTACTGACGATCCAGAAGCAGCAAGGTCT
AGCAATTCCAAAATCACCACCACGCTGGGTCTGGTTGTCCATGCTGCAGCTGATGGTGTTGCTTTGGGA
GCAGCAGCATCTACTTCACAGACCAGTGTCCAGTTAATTGTGTTTGTGGCAATCATGCTACATAAGGCA
CCAGCTGCTTTTGGACTGGTTTCCTTCTTGATGCATGCTGGCTTAGAGCGGAATCGAATCAGAAAGCAC
TTGCTGGTCTTTGCATTGGCAGCACCAGTTATGTCCATGGTGACATACTTAGGACTGAGTAAGAGCAGT
AAAGAAGCCCTTTCAGAGGTGAACGCCACGGGAGTGGCCATGCTTTTCTCTGCCGGGACATTTCTTTAT
GTTGCCACAGTACATGTCCTCCCTGAGGTGGGCGGAATAGGGCACAGCCACAAGCCCGATGCCACGGGA
GGGAGAGGCCTCAGCCGCCTGGAAGTGGCAGCCCTGGTTCTGGGTTGCCTCATCCCTCTCATCCTGTCA
GTAGGACACCAGCATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001252152
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252152.1
RefSeq Size 4853 bp
RefSeq ORF 570 bp
Locus ID 55334
UniProt ID Q9NUM3
Protein Families Transmembrane
MW 19.6 kDa
Gene Summary May act as a zinc-influx transporter.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR, includes an alternate internal exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 4 and 5 both encode isoform (4), which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...