DIPK1A (NM_001252273) Human Untagged Clone

CAT#: SC330281

FAM69A (untagged) - Homo sapiens family with sequence similarity 69, member A (FAM69A), transcript variant 5



  "NM_001252273" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FAM69A
Vector pCMV6-Entry
Sequence Data
>SC330281 representing NM_001252273.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGAGGAGTCTCTGTCCGGGGGCCTGGCTAAGGAAACCCTATTACCTCCAGGCTCGCTTCTCATAT
GTGCGGATGAAATATCTTTTCTTTTCCTGGTTAGTGGTTTTTGTTGGAAGCTGGATTATATATGTGCAG
TATTCTACCTATACAGAATTATGCAGAGGAAAGGACTGTAAGAAAATAATATGTGACAAGTACAAGACT
GGAGTTATTGATGGGCCTGCATGTAACAGCCTTTGTGTTACAGAAACTCTTTACTTTGGAAAATGTTTA
TCCACCAAGCCCAACAATCAGATGTATTTAGGGATTTGGGATAATCTACCAGGTGTTGTGAAATGTCAA
ATGGAACAAGCGCTTCATCTTGATTTTGGAACTGAATTGGAACCAAGAAAAGAAATAGTGCTATTTGAT
AAGCCAACTAGAGGAACTACTGTACAAAAATTTAAAGAAATGGTCTATAGTCTCTTTAAGGACCAGCAC
CGGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001252273
Insert Size 489 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252273.1
RefSeq Size 873 bp
RefSeq ORF 489 bp
Locus ID 388650
UniProt ID Q5T7M9
Protein Families Transmembrane
MW 19 kDa
Gene Summary This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (5) uses an alternate terminal exon, which results in a frameshift and different 3' UTR, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...