Biliverdin Reductase (BLVRA) (NM_001253823) Human Untagged Clone

CAT#: SC330309

BLVRA (untagged) - Homo sapiens biliverdin reductase A (BLVRA), transcript variant 2



  "NM_001253823" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


BLVRA rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BLVR; BVR; BVRA
Vector pCMV6-Entry
Sequence Data
>SC330309 representing NM_001253823.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATGCAGAGCCCGAGAGGAAGTTTGGCGTGGTGGTGGTTGGTGTTGGCCGAGCCGGCTCCGTGCGG
ATGAGGGACTTGCGGAATCCACACCCTTCCTCAGCGTTCCTGAACCTGATTGGCTTCGTGTCGAGAAGG
GAGCTCGGGAGCATTGATGGAGTCCAGCAGATTTCTTTGGAGGATGCTCTTTCCAGCCAAGAGGTGGAG
GTCGCCTATATCTGCAGTGAGAGCTCCAGCCATGAGGACTACATCAGGCAGTTCCTTAATGCTGGCAAG
CACGTCCTTGTGGAATACCCCATGACACTGTCATTGGCGGCCGCTCAGGAACTGTGGGAGCTGGCTGAG
CAGAAAGGAAAAGTCTTGCACGAGGAGCATGTTGAACTCTTGATGGAGGAATTCGCTTTCCTGAAAAAA
GAAGTGGTGGGGAAAGACCTGCTGAAAGGGTCGCTCCTCTTCACAGCTGGCCCGTTGGAAGAAGAGCGG
TTTGGCTTCCCTGCATTCAGCGGCATCTCTCGCCTGACCTGGCTGGTCTCCCTCTTTGGGGAGCTTTCT
CTTGTGTCTGCCACTTTGGAAGAGCGAAAGGAAGATCAGTATATGAAAATGACAGTGTGTCTGGAGACA
GAGAAGAAAAGTCCACTGTCATGGATTGAAGAAAAAGGACCTGGTCTAAAACGAAACAGATATTTAAGC
TTCCATTTCAAGTCTGGGTCCTTGGAGAATGTGCCAAATGTAGGAGTGAATAAGAACATATTTCTGAAA
GATCAAAATATATTTGTCCAGAAACTCTTGGGCCAGTTCTCTGAGAAGGAACTGGCTGCTGAAAAGAAA
CGCATCCTGCACTGCCTGGGGCTTGCAGAAGAAATCCAGAAATATTGCTGTTCAAGGAAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001253823
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253823.1
RefSeq Size 1191 bp
RefSeq ORF 891 bp
Locus ID 644
UniProt ID P53004
Protein Pathways Porphyrin and chlorophyll metabolism
MW 33.4 kDa
Gene Summary The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) contains an additional 5' non-coding exon compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...