NOXA1 (NM_001256068) Human Untagged Clone

CAT#: SC330357

NOXA1 (untagged) - Homo sapiens NADPH oxidase activator 1 (NOXA1), transcript variant 3



  "NM_001256068" in other vectors (2)

CNY 4,090.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NOXA1 Antibody - middle region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NY-CO-31; p51NOX; SDCCAG31
Vector pCMV6-Entry
Sequence Data
>SC330357 representing NM_001256068.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTCTCTGGGGGACCTGGTGCGCGCCTGGCACCTGGGCGCGCAGGCTGTGGATCGTGGGGACTGG
GCCCGCGCCTTGCACCTCTTCTCGGGCGTCCCGGCGCCGCCCGCCAGGCTGTGCTTCAACGCGGGCTGC
GTGCACCTGCTGGCCGGGGACCCCGAGGCCGCGCTGCGGGCATTTGACCAAGCCGTGACCAAGGACACC
TGCATGGCGGTTGGCTTCTTCCAGCGAGGAGTGGCCAACTTCCAGCTGGCAAGGTTCCAGGAGGCTCTG
TCTGACTTCTGGCTGGCCCTGGAGCAGCTGAGGGGCCACGCTGCCATCGACTACACGCAGCTGGGCCTG
CGGTTCAAGCTGCAAGCCTGGGAGGTGCTACACAATGTGGCGTCGGCACAGTGCCAGCTGGGGCTCTGG
ACAGAGGCGGCCAGCAGCCTAAGGGAGGCCATGTCCAAGTGGCCGGAGGGGTCCCTGAATGGCCTGGAC
TCAGCCCTGGACCAAGTGCAGGGACCAGGAGCGAACCATGATGCCAGGTCCCTAATCATGGACTCCCCA
AGAGCTGGCACCCACCAGGGCCCCCTCGATGCAGAGACAGAGGTCGGTGCTGACCGCTGCACGTCGACT
GCCTACCAGGAGCAGAGGCCCCAGGTGGAGCAAGTTGGCAAACAGGCTCCTCTCTCCCCAGGGCTGCCG
GCAATGGGGGGGCCTGGCCCCGGCCCCTGTGAGGACCCCGCGGGTGCTGGGGGAGCAGGTGCAGGGGGC
TCCGAGCCCCTGGTGACTGTCACCGTGCAGTGCGCCTTCACAGTGGCCCTGAGGGCACGAAGAGGAGCC
GACCTGTCCAGCCTGCGGGCACTGCTGGGCCAAGCCCTCCCTCACCAGGCCCAGCTTGGGCAACTCAGT
TACCTAGCCCCAGGTGAGGACGGGCACTGGGTCCCCATCCCCGAGGAGGAGTCGCTGCAGAGGGCCTGG
CAGGACGCAGCTGCCTGCCCCAGGGGGCTGCAGCTGCAGTGCAGGGGAGCCGGGGGTCGGCCGGTCCTC
TACCAGGTGGTGGCCCAGCACAGCTACTCCGCCCAGGGGCCAGAGGACCTGGGCTTCCGACAGGGGGAC
ACGGTGGACGTCCTGTGTGAAGAGCCCGATGTCCCCCTTGCAGTGGACCAGGCATGGCTGGAGGGCCAC
TGTGACGGCCGCATCGGCATCTTCCCCAAGTGCTTCGTGGTCCCCGCCGGCCCTCGGATGTCAGGAGCC
CCCGGCCGCCTGCCCCGATCCCAGCAGGGAGATCAGCCCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256068
Insert Size 1284 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256068.1
RefSeq Size 1471 bp
RefSeq ORF 1284 bp
Locus ID 10811
UniProt ID Q86UR1
MW 45.2 kDa
Gene Summary This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) lacks two alternate in-frame exons in the 3' coding region compared to variant 1. The resulting protein (isoform 3) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...