Kallikrein 2 (KLK2) (NM_001256080) Human Untagged Clone

CAT#: SC330358

KLK2 (untagged) - Homo sapiens kallikrein-related peptidase 2 (KLK2), transcript variant 3



  "NM_001256080" in other vectors (2)

CNY 1,320.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
KLK2 mouse monoclonal antibody, clone OTI5D6 (formerly 5D6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hGK-1; hK2; KLK2A2
Vector pCMV6-Entry
Sequence Data
>SC330358 representing NM_001256080.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCCTTCTGAAGCATCAAAGCCTTAGACCAGATGAAGACTCCAGCCATGACCTCATGCTGCTCCGC
CTGTCAGAGCCTGCCAAGATCACAGATGTTGTGAAGGTCCTGGGCCTGCCCACCCAGGAGCCAGCACTG
GGGACCACCTGCTACGCCTCAGGCTGGGGCAGCATCGAACCAGAGGAGTTCTTGCGCCCCAGGAGTCTT
CAGTGTGTGAGCCTCCATCTCCTGTCCAATGACATGTGTGCTAGAGCTTACTCTGAGAAGGTGACAGAG
TTCATGTTGTGTGCTGGGCTCTGGACAGGTGGTAAAGACACTTGTGGGGGTGATTCTGGGGGTCCACTT
GTCTGTAATGGTGTGCTTCAAGGTATCACATCATGGGGCCCTGAGCCATGTGCCCTGCCTGAAAAGCCT
GCTGTGTACACCAAGGTGGTGCATTACCGGAAGTGGATCAAGGACACCATCGCAGCCAACCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256080
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256080.1
RefSeq Size 2695 bp
RefSeq ORF 480 bp
Locus ID 3817
UniProt ID P20151
Protein Families Druggable Genome, Protease
MW 17.3 kDa
Gene Summary This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...