CHIT1 (NM_001256125) Human Untagged Clone

CAT#: SC330368

CHIT1 (untagged) - Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 2



  "NM_001256125" in other vectors (2)

CNY 4,280.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CHIT1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHI3; CHIT; CHITD
Vector pCMV6-Entry
Sequence Data
>SC330368 representing NM_001256125.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCGGTCTGTGGCCTGGGCAGGTTTCATGGTCCTGCTGATGATCCCATGGGGCTCTGCTGCAAAA
CTGGTCTGCTACTTCACCAACTGGGCCCAGTACAGACAGGGGGAGGCTCGCTTCCTGCCCAAGGACTTG
GACCCCAGCCTTTGCACCCACCTCATCTACGCCTTCGCTGGCATGACCAACCACCAGCTGAGCACCACT
GAGTGGAATGACGAGACTCTCTACCAGGAGTTCAATGGCCTGAAGAAGATGTTCACAGATATGGTAGCC
ACGGCCAACAACCGTCAGACCTTTGTCAACTCGGCCATCAGGTTTCTGCGCAAATACAGCTTTGACGGC
CTTGACCTTGACTGGGAGTACCCAGGAAGCCAGGGGAGCCCTGCCGTAGACAAGGAGCGCTTCACAACC
CTGGTACAGGACTTGGCCAATGCCTTCCAGCAGGAAGCCCAGACCTCAGGGAAGGAACGCCTTCTTCTG
AGTGCAGCGGTTCCAGCTGGGCAGACCTATGTGGATGCTGGATACGAGGTGGACAAAATCGCCCAGAAC
CTGGATTTTGTCAACCTTATGGCCTACGACTTCCATGGCTCTTGGGAGAAGGTCACGGGACATAACAGC
CCCCTCTACAAGAGGCAAGAAGAGAGTGGTGCAGCAGCCAGCCTCAACGTGGATGCTGCTGTGCAACAG
TGGCTGCAGAAGGGGACCCCTGCCAGCAAGCTGATCCTTGGCATGCCTACCTACGGACGCTCCTTCACA
CTGGCCTCCTCATCAGACACCAGAGTGGGGGCCCCAGCCACAGGGTCTGGCACTCCAGGCCCCTTCACC
AAGGAAGGAGGGATGCTGGCCTACTATGAAGTCTGCTCCTGGAAGGGGGCCACCAAACAGAGAATCCAG
GATCAGAAGGTGCCCTACATCTTCCGGGACAACCAGTGGGTGGGCTTTGATGATGTGGAGAGCTTCAAA
ACCAAGGTCAGCTATCTGAAGCAGAAGGGACTGGGCGGGGCCATGGTCTGGGCACTGGACTTAGATGAC
TTTGCCGGCTTCTCCTGCAACCAGGGCCGATACCCCCTCATCCAGACGCTACGGCAGGAACTGAGTCTT
CCATACTTGCCTTCAGGCACCCCAGAGCTTGAAGTTCCAAAACCAGGTCAGCCCTCTGAACCTGAGCAT
GGCCCCAGCCCTGGACAAGACACGTTCTGCCAGGGCAAAGCTGATGGGCTCTATCCCAATCCTCGGGAA
CGGTCCAGCTTCTACAGCTGTGCAGCGGGGCGGCTGTTCCAGCAAAGCTGCCCGACAGGCCTGGTGTTC
AGCAACTCCTGCAAATGCTGCACCTGGAATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256125
Insert Size 1344 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256125.1
RefSeq Size 2268 bp
RefSeq ORF 1344 bp
Locus ID 1118
UniProt ID Q13231
Protein Families Secreted Protein, Transmembrane
Protein Pathways Amino sugar and nucleotide sugar metabolism
MW 49.6 kDa
Gene Summary Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) is shorter, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species and on the presence of a predicted signal peptide in the protein N-terminus. An upstream in-frame start codon is also present but is poorly conserved, and use of the upstream start codon would result in a protein that is 10 aa longer at the N-terminus and lacks a predicted signal peptide. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...