MELK (NM_001256693) Human Untagged Clone

CAT#: SC330496

MELK (untagged) - Homo sapiens maternal embryonic leucine zipper kinase (MELK), transcript variant 9



  "NM_001256693" in other vectors (2)

CNY 4,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Polyclonal Antibody against MELK
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPK38
Vector pCMV6-Entry
Sequence Data
>SC330496 representing NM_001256693.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCATACTGTTATATGTTCTTATGTGTGGATTTCTACCATTTGATGATGATAATGTAATGGCTTTA
TACAAGAAGATTATGAGAGGAAAATATGATGTTCCCAAGTGGCTCTCTCCCAGTAGCATTCTGCTTCTT
CAACAAATGCTGCAGGTGGACCCAAAGAAACGGATTTCTATGAAAAATCTATTGAACCATCCCTGGATC
ATGCAAGATTACAACTATCCTGTTGAGTGGCAAAGCAAGAATCCTTTTATTCACCTCGATGATGATTGC
GTAACAGAACTTTCTGTACATCACAGAAACAACAGGCAAACAATGGAGGATTTAATTTCACTGTGGCAG
TATGATCACCTCACGGCTACCTATCTTCTGCTTCTAGCCAAGAAGGCTCGGGGAAAACCAGTTCGTTTA
AGGCTTTCTTCTTTCTCCTGTGGACAAGCCAGTGCTACCCCATTCACAGACATCAAGTCAAATAATTGG
AGTCTGGAAGATGTGACCGCAAGTGATAAAAATTATGTGGCGGGATTAATAGACTATGATTGGTGTGAA
GATGATTTATCAACAGGTGCTGCTACTCCCCGAACATCACAGTTTACCAAGTACTGGACAGAATCAAAT
GGGGTGGAATCTAAATCATTAACTCCAGCCTTATGCAGAACACCTGCAAATAAATTAAAGAACAAAGAA
AATGTATATACTCCTAAGTCTGCTGTAAAGAATGAAGAGTACTTTATGTTTCCTGAGCCAAAGACTCCA
GTTAATAAGAACCAGCATAAGAGAGAAATACTCACTACGCCAAATCGTTACACTACACCCTCAAAAGCT
AGAAACCAGTGCCTGAAAGAAACTCCAATTAAAATACCAGTAAATTCAACAGGAACAGACAAGTTAATG
ACAGGTGTCATTAGCCCTGAGAGGCGGTGCCGCTCAGTGGAATTGGATCTCAACCAAGCACATATGGAG
GAGACTCCAAAAAGAAAGGGAGCCAAAGTGTTTGGGAGCCTTGAAAGGGGGTTGGATAAGGTTATCACT
GTGCTCACCAGGAGCAAAAGGAAGGGTTCTGCCAGAGACGGGCCCAGAAGACTAAAGCTTCACTATAAC
GTGACTACAACTAGATTAGTGAATCCAGATCAACTGTTGAATGAAATAATGTCTATTCTTCCAAAGAAG
CATGTTGACTTTGTACAAAAGGGTTATACACTGAAGTGTCAAACACAGTCAGATTTTGGGAAAGTGACA
ATGCAATTTGAATTAGAAGTGTGCCAGCTTCAAAAACCCGATGTGGTGGGTATCAGGAGGCAGCGGCTT
AAGGGCGATGCCTGGGTTTACAAAAGATTAGTGGAAGACATCCTATCTAGCTGCAAGGTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256693
Insert Size 1374 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256693.1
RefSeq Size 2300 bp
RefSeq ORF 1374 bp
Locus ID 9833
UniProt ID Q14680
Protein Families Druggable Genome, Protein Kinase
MW 52.5 kDa
Gene Summary Serine/threonine-protein kinase involved in various processes such as cell cycle regulation, self-renewal of stem cells, apoptosis and splicing regulation. Has a broad substrate specificity; phosphorylates BCL2L14, CDC25B, MAP3K5/ASK1 and ZNF622. Acts as an activator of apoptosis by phosphorylating and activating MAP3K5/ASK1. Acts as a regulator of cell cycle, notably by mediating phosphorylation of CDC25B, promoting localization of CDC25B to the centrosome and the spindle poles during mitosis. Plays a key role in cell proliferation and carcinogenesis. Required for proliferation of embryonic and postnatal multipotent neural progenitors. Phosphorylates and inhibits BCL2L14, possibly leading to affect mammary carcinogenesis by mediating inhibition of the pro-apoptotic function of BCL2L14. Also involved in the inhibition of spliceosome assembly during mitosis by phosphorylating ZNF622, thereby contributing to its redirection to the nucleus. May also play a role in primitive hematopoiesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (9) lacks two consecutive exons in the 5' region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (9) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...