Apc10 (ANAPC10) (NM_001256707) Human Untagged Clone

CAT#: SC330503

ANAPC10 (untagged) - Homo sapiens anaphase promoting complex subunit 10 (ANAPC10), transcript variant 3



  "NM_001256707" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-ANAPC10 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APC10; DOC1
Vector pCMV6-Entry
Sequence Data
>SC330503 representing NM_001256707.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTACACCAAACAAGACACCTCCTGGTGCTGACCCCAAGCAGTTGGAAAGGACTGGAACAGTACGG
GAAATTGGGTCACAAGCTGTTTGGTCACTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGA
GATGACAATCTAGAAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAGA
AGAAAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAAAGCTATACTCCAAGC
AAGATCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTCAAGAAATTCGGCAACTTGAGTTGGTGGAA
CCAAGTGGCTGGATTCATGTTCCCTTAACTGACAATCATAAGAAGCCAACTCGTACATTCATGATACAG
ATTGCTGTTCTAGCCAATCACCAGAATGGAAGAGACACCCATATGAGACAAATTAAAATATACACACCA
GTAGAAGAGAGCTCCATTGGTAAATTTCCTAGATGTACAACTATAGATTTCATGATGTATCGTTCAATA
AGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256707
Insert Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256707.1
RefSeq Size 1541 bp
RefSeq ORF 558 bp
Locus ID 10393
UniProt ID Q9UM13
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
MW 21.3 kDa
Gene Summary ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]).[supplied by OMIM, Feb 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...