GDAP1L1 (NM_001256740) Human Untagged Clone

CAT#: SC330512

GDAP1L1 (untagged) - Homo sapiens ganglioside induced differentiation associated protein 1-like 1 (GDAP1L1), transcript variant 5



  "NM_001256740" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GDAP1L1 mouse monoclonal antibody, clone OTI1G5 (formerly 1G5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ881L22.1; dJ995J12.1.1
Vector pCMV6-Entry
Sequence Data
>SC330512 representing NM_001256740.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGACCCCCAACAATCTGACCCCCACCAACTGCAGCTGGTGGCCCATCTCCGCGCTGGAGAGCGAT
GCGGCCAAGCCAGCGGAGGCCCCCGACGCTCCCGAGGCGGCCAGCCCCGCCCATTGGCCCAGGGAGAGC
CTGGTTCTGTACCACTGGACCCAGTCCTTCAGCTCGCAGAAGGTGCGGCTGGTGATCGCCGAGAAGGGC
CTGGTGTGCGAGGAGCGGGACGTGAGCCTGCCACAGAGCGAGCACAAGGAGCCCTGGTTCATGCGGCTC
AACCTGGGCGAGGAGGTGCCCGTCATCATCCACCGCGACAACATCATCAGTGACTATGACCAGATCATT
GACTATGTGGAGCGCACCTTCACAGGAGAGCACGTGGTGGCCCTGATGCCCGAGGTGGGCAGCCTGCAG
CACGCACGGGTGCTGCAGTACCGGGAGCTGCTGGACGCACTGCCCATGGATGCCTACACGCATGGCTGC
ATCCTGCATCCCGAGCTCACCACCGACTCCATGATCCCCAAGTACGCCACGGCCGAGATCCGCAGGCAG
AAATGCGAGCTGTGGCTCTGTGGCTGTGCCTTCACCCTCGCTGATGTCCTCCTGGGAGCCACCCTGCAC
CGCCTCAAGTTCCTGGGACTGTCCAAGAAATACTGGGAAGATGGCAGCCGGCCCAACCTGCAGTCCTTC
TTTGAGAGGGTCCAGAGACGCTTTGCCTTCCGGAAAGTCCTGGGTGACATCCACACCACCCTGCTGTCG
GCCGTCATCCCCAATGCTTTCCGGCTGGTCAAGAGGAAACCCCCATCCTTCTTCGGGGCGTCCTTCCTC
ATGGGCTCCCTGGGTGGGATGGGCTACTTTGCCTACTGGTACCTCAAGAAAAAATACATCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256740
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256740.1
RefSeq Size 2585 bp
RefSeq ORF 891 bp
Locus ID 78997
UniProt ID Q96MZ0
Protein Families Transmembrane
MW 33.8 kDa
Gene Summary The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (5) uses an alternate in-frame splice junction at the 5' end of an exon and lacks an alternate in-frame segment compared to variant 1. The resulting isoform (5) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...