BMPR1B (NM_001256794) Human Untagged Clone

CAT#: SC330520

BMPR1B (untagged) - Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant 4



  "NM_001256794" in other vectors (2)

CNY 4,750.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
BMPR1B Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALK-6; ALK6; AMDD; BDA1D; BDA2; CDw293
Vector pCMV6-Entry
Sequence Data
>SC330520 representing NM_001256794.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTTTTGCGAAGTGCAGGAAAATTAAATGTGGGCACCAAGAAAGAGGATGGTGAGAGTACAGCCCCC
ACCCCCCGTCCAAAGGTCTTGCGTTGTAAATGCCACCACCATTGTCCAGAAGACTCAGTCAACAATATT
TGCAGCACAGACGGATATTGTTTCACGATGATAGAAGAGGATGACTCTGGGTTGCCTGTGGTCACTTCT
GGTTGCCTAGGACTAGAAGGCTCAGATTTTCAGTGTCGGGACACTCCCATTCCTCATCAAAGAAGATCA
ATTGAATGCTGCACAGAAAGGAACGAATGTAATAAAGACCTACACCCTACACTGCCTCCATTGAAAAAC
AGAGATTTTGTTGATGGACCTATACACCACAGGGCTTTACTTATATCTGTGACTGTCTGTAGTTTGCTC
TTGGTCCTTATCATATTATTTTGTTACTTCCGGTATAAAAGACAAGAAACCAGACCTCGATACAGCATT
GGGTTAGAACAGGATGAAACTTACATTCCTCCTGGAGAATCCCTGAGAGACTTAATTGAGCAGTCTCAG
AGCTCAGGAAGTGGATCAGGCCTCCCTCTGCTGGTCCAAAGGACTATAGCTAAGCAGATTCAGATGGTG
AAACAGATTGGAAAAGGTCGCTATGGGGAAGTTTGGATGGGAAAGTGGCGTGGCGAAAAGGTAGCTGTG
AAAGTGTTCTTCACCACAGAGGAAGCCAGCTGGTTCAGAGAGACAGAAATATATCAGACAGTGTTGATG
AGGCATGAAAACATTTTGGGTTTCATTGCTGCAGATATCAAAGGGACAGGGTCCTGGACCCAGTTGTAC
CTAATCACAGACTATCATGAAAATGGTTCCCTTTATGATTATCTGAAGTCCACCACCCTAGACGCTAAA
TCAATGCTGAAGTTAGCCTACTCTTCTGTCAGTGGCTTATGTCATTTACACACAGAAATCTTTAGTACT
CAAGGCAAACCAGCAATTGCCCATCGAGATCTGAAAAGTAAAAACATTCTGGTGAAGAAAAATGGAACT
TGCTGTATTGCTGACCTGGGCCTGGCTGTTAAATTTATTAGTGATACAAATGAAGTTGACATACCACCT
AACACTCGAGTTGGCACCAAACGCTATATGCCTCCAGAAGTGTTGGACGAGAGCTTGAACAGAAATCAC
TTCCAGTCTTACATCATGGCTGACATGTATAGTTTTGGCCTCATCCTTTGGGAGGTTGCTAGGAGATGT
GTATCAGGAGGTATAGTGGAAGAATACCAGCTTCCTTATCATGACCTAGTGCCCAGTGACCCCTCTTAT
GAGGACATGAGGGAGATTGTGTGCATCAAGAAGTTACGCCCCTCATTCCCAAACCGGTGGAGCAGTGAT
GAGTGTCTAAGGCAGATGGGAAAACTCATGACAGAATGCTGGGCTCACAATCCTGCATCAAGGCTGACA
GCCCTGCGGGTTAAGAAAACACTTGCCAAAATGTCAGAGTCCCAGGACATTAAACTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256794
Insert Size 1509 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256794.1
RefSeq Size 5440 bp
RefSeq ORF 1509 bp
Locus ID 658
UniProt ID O00238
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
MW 56.9 kDa
Gene Summary This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...