SEPTIN4 (NM_001256822) Human Untagged Clone

CAT#: SC330525

SEPT4 (untagged) - Homo sapiens septin 4 (SEPT4), transcript variant 6



  "NM_001256822" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Septin 4 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARTS; BRADEION; C17orf47; CE5B3; H5; hCDCREL-2; hucep-7; MART; PNUTL2; SEP4; SEPT4
Vector pCMV6-Entry
Sequence Data
>SC330525 representing NM_001256822.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGCAGGAGAGTCTGGCCTGGGCAAATCCACACTTGTCAATAGCCTCTTCCTCACTGATCTGTAC
CGGGACCGGAAACTTCTTGGTGCTGAAGAGAGGATCATGCAAACTGTGGAGATCACTAAGCATGCAGTG
GACATAGAAGAGAAGGGTGTGAGGCTGCGGCTCACCATTGTGGACACACCAGGTTTTGGGGATGCAGTC
AACAACACAGAGTGCTGGAAGCCTGTGGCAGAATACATTGATCAGCAGTTTGAGCAGTATTTCCGAGAC
GAGAGTGGCCTGAACCGAAAGAACATCCAAGACAACAGGGTGCACTGCTGCCTGTACTTCATCTCACCC
TTCGGCCATGGGCTCCGGCCATTGGATGTTGAATTCATGAAGGCCCTGCATCAGCGGGTCAACATCGTG
CCTATCCTGGCTAAGGCAGACACACTGACACCTCCCGAAGTGGACCACAAGAAACGCAAAATCCGGGAG
GAGATTGAGCATTTTGGAATCAAGATCTATCAATTCCCAGACTGTGACTCTGATGAGGATGAGGACTTC
AAATTGCAGGACCAAGCCCTAAAGGAAAGCATCCCATTTGCAGTAATTGGCAGCAACACTGTAGTAGAG
GCCAGAGGGCGGCGAGTTCGGGGTCGACTCTACCCCTGGGGCATCGTGGAAGTGGAAAACCCAGGGCAC
TGCGACTTTGTGAAGCTGAGGACAATGCTGGTACGTACCCACATGCAGGACCTGAAGGATGTGACACGG
GAGACACATTATGAGAACTACCGGGCACAGTGCATCCAGAGCATGACCCGCCTGGTGGTGAAGGAACGG
AATCGCAACAAACTGACTCGGGAAAGTGGTACCGACTTCCCCATCCCTGCTGTCCCACCAGGGACAGAT
CCAGAAACTGAGAAGCTTATCCGAGAGAAAGATGAGGAGCTGCGGCGGATGCAGGAGATGCTACACAAA
ATACAAAAACAGATGAAGGAGAACTATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256822
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256822.1
RefSeq Size 1777 bp
RefSeq ORF 996 bp
Locus ID 5414
UniProt ID O43236
MW 38.5 kDa
Gene Summary This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 7. The encoded isoform (6) is shorter than isoform 5.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...