ST3GAL3 (NM_001270462) Human Untagged Clone
CAT#: SC330842
ST3GAL3 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 14
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEE15; EIEE15; MRT12; SIAT6; ST3GALII; ST3Gal III; ST3GalIII; ST3N |
Vector | pCMV6-Entry |
Sequence Data |
>SC330842 representing NM_001270462.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGACTCTTGGTATTTGTGCGCAATCTGCTGCTAGCCCTCTGCCTCTTTCTGGTACTGGGATTTTTG TATTATTCTGCGTGGAAGCTACACTTACTCCAGTGGGAGGAGGACTCCAAGTATGATCGGTTGGGCTTC CTCCTGAATCTGGACTCTAAACTGTTCTCCAAGCCAGCACCCATGTTCCTGGATGACTCCTTTCGCAAG TGGGCTAGAATCCGGGAGTTCGTGCCGCCTTTTGGGATCAAAGGTCAAGACAATCTGATCAAAGCCATC TTGTCAGTCACCAAAGAGTACCGCCTGACCCCTGCCTTGGACAGCCTCCGCTGCCGCCGCTGCATCATC GTGGGCAATGGAGGCGTTCTTGCCAACAAGTCTCTGGGGTCACGAATTGACGACTATGACATTGTGGTG AGACTGAATTCAGCACCAGTGAAAGGCTTTGAGAAGGACGTGGGCAGCAAAACGACACTGCGCATCACC TACCCCGAGGGCGCCATGCAGCGGCCTGAGCAGTACGAGCGCGATTCTCTCTTTGTCCTCGCCGGCTTC AAGTGGCAGGACTTTAAGTGGTTGAAATACATCGTCTACAAGGAGAGAGTGTCCTGGACGCACAATATC CAGCGAGAGAAAGAGTTTCTGCGGAAGCTGGTGAAAGCTCGCGTCATCACTGATCTAAGCAGTGGCATC TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270462 |
Insert Size | 693 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270462.1 |
RefSeq Size | 1859 bp |
RefSeq ORF | 693 bp |
Locus ID | 6487 |
UniProt ID | Q11203 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways |
MW | 26.8 kDa |
Gene Summary | The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with a form of autosomal recessive nonsymdromic cognitive disability as well as infantile epileptic encephalopathy. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (14) uses an alternate in-frame splice site in the 5' coding region, lacks five alternate in-frame exons compared to variant 1. The resulting isoform (n, also called C11) is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232216 | ST3GAL3 (Myc-DDK tagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 14 |
CNY 3,990.00 |
|
RG232216 | ST3GAL3 (tGFP-tagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 14 |
CNY 4,370.00 |
其它ST3GAL3产品