BRP44L (MPC1) (NM_001270879) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	BRP44L; CGI-129; MPYCD; SLC54A1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330880 representing NM_001270879. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAAAAGTCTCCAGAGATTATCAGTGGGCGGATGACATTTGCCCTCTGTTGCTATTCTTTGACATTC ATGAGATTTGCCTACAAGGTACAGCCTCGGAACTGGCTTCTGTTTGCATGCCACGCAACAAATGAAGTA GCCCAGCTCATCCAGGGAGGGCGGCTTATCAAACACGAGATGACTAAAACGGCATCTGCATAA
Restriction Sites	SgfI-MluI
ACCN	NM_001270879
Insert Size	201 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001270879.1
RefSeq Size	1193 bp
RefSeq ORF	201 bp
Locus ID	51660
MW	7.5 kDa
Gene Summary	The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) contains an alternate exon compared to variant 1. This results in a distinct 5' UTR and causes translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.