IFIT1 (NM_001270930) Human Untagged Clone

CAT#: SC330894

IFIT1 (untagged) - Homo sapiens interferon-induced protein with tetratricopeptide repeats 1 (IFIT1), transcript variant 5



  "NM_001270930" in other vectors (2)

CNY 4,280.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
IFIT1 mouse monoclonal antibody, clone OTI3G8 (formerly 3G8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C56; G10P1; IFI-56; IFI-56K; IFI56; IFIT-1; IFNAI1; ISG56; P56; RNM561
Vector pCMV6-Entry
Sequence Data
>SC330894 representing NM_001270930.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTGATTTAGAAAACAGAGTCTTGGATCAGATTGAATTCCTAGACACCAAATACAGTGTGGGAATA
CACAACCTACTAGCCTATGTGAAACACCTGAAAGGCCAGAATGAGGAAGCCCTGAAGAGCTTAAAAGAA
GCTGAAAACTTAATGCAGGAAGAACATGACAACCAAGCAAATGTGAGGAGTCTGGTGACCTGGGGCAAC
TTTGCCTGGATGTATTACCACATGGGCAGACTGGCAGAAGCCCAGACTTACCTGGACAAGGTGGAGAAC
ATTTGCAAGAAGCTTTCAAATCCCTTCCGCTATAGAATGGAGTGTCCAGAAATAGACTGTGAGGAAGGA
TGGGCCTTGCTGAAGTGTGGAGGAAAAAATTATGAACGGGCCAAGGCCTGCTTTGAAAAGGTGCTTGAA
GTGGACCCTGAAAACCCTGAATCCAGCGCTGGGTATGCGATCTCTGCCTATCGCCTGGATGGCTTTAAA
TTAGCCACAAAAAATCACAAGCCATTTTCTTTGCTTCCCCTAAGGCAGGCTGTCCGCTTAAATCCAGAC
AATGGATATATTAAGGTTCTCCTTGCCCTGAAGCTTCAGGATGAAGGACAGGAAGCTGAAGGAGAAAAG
TACATTGAAGAAGCTCTAGCCAACATGTCCTCACAGACCTATGTCTTTCGATATGCAGCCAAGTTTTAC
CGAAGAAAAGGCTCTGTGGATAAAGCTCTTGAGTTATTAAAAAAGGCCTTGCAGGAAACACCCACTTCT
GTCTTACTGCATCACCAGATAGGGCTTTGCTACAAGGCACAAATGATCCAAATCAAGGAGGCTACAAAA
GGGCAGCCTAGAGGGCAGAACAGAGAAAAGCTAGACAAAATGATAAGATCAGCCATATTTCATTTTGAA
TCTGCAGTGGAAAAAAAGCCCACATTTGAGGTGGCTCATCTAGACCTGGCAAGAATGTATATAGAAGCA
GGCAATCACAGAAAAGCTGAAGAGAATTTTCAAAAATTGTTATGCATGAAACCAGTGGTAGAAGAAACA
ATGCAAGACATACATTTCCACTATGGTCGGTTTCAGGAATTTCAAAAGAAATCTGACGTCAATGCAATT
ATCCATTATTTAAAAGCTATAAAAATAGAACAGGCATCATTAACAAGGGATAAAAGTATCAATTCTTTG
AAGAAATTGGTTTTAAGGAAACTTCGGAGAAAGGCATTAGATCTGGAAAGCTTGAGCCTCCTTGGGTTC
GTCTACAAATTGGAAGGAAATATGAATGAAGCCCTGGAGTACTATGAGCGGGCCCTGAGACTGGCTGCT
GACTTTGAGAACTCTGTGAGACAAGGTCCTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270930
Insert Size 1344 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270930.1
RefSeq Size 4631 bp
RefSeq ORF 1344 bp
Locus ID 3434
UniProt ID P09914
MW 51.7 kDa
Gene Summary This gene encodes a protein containing tetratricopeptide repeats that was originally identified as induced upon treatment with interferon. The encoded protein may inhibit viral replication and translational initiation. This gene is located in a cluster on chromosome 10 with five other closely related genes. There is a pseudogene for this gene on chromosome 13. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (5) contains an alternate internal exon and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3, 4, and 5 encode the same isoform (3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...