RAP2C (NM_001271186) Human Untagged Clone

CAT#: SC330928

RAP2C (untagged) - Homo sapiens RAP2C, member of RAS oncogene family (RAP2C), transcript variant 1



  "NM_001271186" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to RAP2C (RAP2C, member of RAS oncogene family)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330928 representing NM_001271186.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGGAATACAAGGTAGTGGTGTTAGGGAGTGGAGGGGTTGGCAAATCTGCCCTTACTGTGCAGTTT
GTCACTGGGACTTTCATTGAGAAATATGACCCCACCATTGAAGATTTCTACCGCAAAGAGATCGAAGTG
GACTCTTCCCCCTCCGTGCTGGAAATTCTGGACACCGCAGGAACTGAGCAGTTTGCCTCCATGAGAGAT
CTCTACATCAAAAACGGCCAAGGTTTCATCCTGGTTTATAGCCTGGTTAATCAACAGTCTTTTCAGGAT
ATCAAGCCAATGAGAGATCAAATTGTCAGAGTGAAGAGATATGAAAAAGTCCCACTAATCCTAGTAGGA
AATAAAGTGGATCTGGAACCAGAAAGAGAGGTTATGTCTTCAGAAGGCAGAGCTCTGGCTCAAGAATGG
GGCTGTCCTTTCATGGAGACATCGGCAAAAAGTAAATCAATGGTGGATGAACTTTTTGCTGAGATCGTC
AGGCAAATGAACTATTCATCCCTGCCGGAGAAGCAAGATCAGTGTTGTACAACTTGTGTCGTCCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271186
Insert Size 552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271186.1
RefSeq Size 4006 bp
RefSeq ORF 552 bp
Locus ID 57826
UniProt ID Q9Y3L5
Protein Families Druggable Genome
MW 20.7 kDa
Gene Summary The protein encoded by this gene is a member of the Ras-related protein subfamily of the Ras GTPase superfamily. Members of this family are small GTPases that act as molecular switches to regulate cellular proliferation, differentiation, and apoptosis. This protein has been reported to activate in vitro transcriptional activity of the serum response element. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...