DEFB119 (NM_001271209) Human Untagged Clone

CAT#: SC330931

DEFB119 (untagged) - Homo sapiens defensin, beta 119 (DEFB119), transcript variant 4



  "NM_001271209" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DEFB119 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEFB-19; DEFB-20; DEFB20; DEFB120; ESC42-RELA; ESC42-RELB
Vector pCMV6-Entry
Sequence Data
>SC330931 representing NM_001271209.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAACTTCTTTACCTGTTTCTTGCCATCCTTCTGGCCATAGAAGAACCAGTGATATCAGAGTGTTGG
ATGGATGGACACTGCCGGTTGTTGTGCAAAGATGGTGAAGACAGCATCATACGCTGCCGAAATCGTAAA
CGGTGCTGTGTTCCTAGTCGTTATTTAACAATCCAACCAGTAACAATTCATGGAATCCTTGGCTGGACC
ACTCCTCAGATGTCCACAACAGCTCCAAAAATGAAGACAAATATAACTAATAGATAG

Restriction Sites SgfI-MluI     
ACCN NM_001271209
Insert Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271209.1
RefSeq Size 510 bp
RefSeq ORF 264 bp
Locus ID 245932
UniProt ID Q8N690
Protein Families Secreted Protein
MW 10 kDa
Gene Summary This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 3' exon, compared to variant 3. Then encoded isoform (d) is shorter than isoform c. Isoform d is thought to be an antimicrobial peptide.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...