PYCR2 (NM_001271681) Human Untagged Clone

CAT#: SC330952

PYCR2 (untagged) - Homo sapiens pyrroline-5-carboxylate reductase family, member 2 (PYCR2), transcript variant 2



  "NM_001271681" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PYCR2 mouse monoclonal antibody, clone OTI4A10 (formerly 4A10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HLD10; P5CR2
Vector pCMV6-Entry
Sequence Data
>SC330952 representing NM_001271681.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGTGGGCTTCATCGGGGCCGGCCAGCTGGCCTATGCTCTGGCGCGGGGCTTCACGGCCGCAGGC
ATCCTGTCGGCTCACAAGATAATAGCCAGCTCCCCAGAAATGAACCTGCCCACGGTGTCCGCGCTCAGG
AAGATGGGTGTGAACCTGACACGCAGCAACAAGGAGACGGTGAAGCACAGCGACGTCCTGTTTCTGGCT
GTGAAGCCACATATCATCCCCTTCATCCTGGATGAGATTGGGGCCGACGTGCAAGCCAGACACATCGTG
GTCTCCTGTGCGGCTGGTGTCACCATCAGCTCTGTGGAGAAGGCATTCATGGCTCTGGACGCATTGGCT
GATGGTGGGGTGAAGATGGGTTTGCCACGGCGCCTGGCAATCCAACTCGGGGCCCAGGCTTTGCTGGGA
GCTGCCAAGATGCTGCTGGACTCGGAGCAGCATCCATGCCAGCTTAAGGACAATGTCTGCTCCCCTGGG
GGAGCCACCATCCACGCCCTGCACTTTCTAGAGAGTGGGGGCTTCCGCTCTCTGCTCATCAATGCAGTT
GAGGCCTCCTGTATCCGAACACGAGAGCTACAGTCCATGGCCGACCAAGAAAAGATCTCCCCAGCTGCC
CTTAAGAAGACCCTCTTAGACAGAGTGAAGCTGGAATCCCCCACAGTCTCCACACTGACCCCCTCCAGC
CCAGGGAAGCTCCTCACAAGAAGCCTGGCCCTGGGAGGCAAGAAGGACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271681
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271681.1
RefSeq Size 1549 bp
RefSeq ORF 741 bp
Locus ID 29920
UniProt ID Q96C36
Protein Pathways Arginine and proline metabolism, Metabolic pathways
MW 25.9 kDa
Gene Summary This gene belongs to the pyrroline-5-carboxylate reductase family. The encoded mitochondrial protein catalyzes the conversion of pyrroline-5-carboxylate to proline, which is the last step in proline biosynthesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...