ABHD10 (NM_001272069) Human Untagged Clone

CAT#: SC331032

ABHD10 (untagged) - Homo sapiens abhydrolase domain containing 10 (ABHD10), transcript variant 2



  "NM_001272069" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ABHD10 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331032 representing NM_001272069.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGTTGCGCGCTTGGCAGCTGTGGCGGCCTGGGTACCTTGTCGGAGCTGGGGCTGGGCAGCCGTC
CCCTTCGGTCCCCACCGTGGCCTCAGCGTGCTGCTTGCACGGATACCTCAGCGGGCGCCACGGTGGCTC
CCAGCTTGTAGACAAAAGACGTCACTCTCATTCCTTAATCGACCAGACCTTCCAAACCTGGCTTATAAG
AAGCTAAAAGGCAAAAGTCCAGGAATTATCTTCATCCCTGGCTATCTTTCTTATATGAATGGTACAAAA
GCGTTGGCGATTGAGGAGTTTTGCAAATCTCTAGGTCACGCCTGCATAAGGTTTGATTACTCAGGAGTT
GGAAGTTCAGATGGTAACTCAGAGGAAAGCACACTGGGGAAATGGAGAAAAGATGTTCTTTCTATAATT
GATGACTTAGCTGATGGGCCACAGATTCTTGTTGGATCTAGCCTTGGAGGGTGGCTTATGCTTCATGCT
GCAATTGCACGACCAGAGAAGGTCGTGGCTCTTATTGGTGTAGCTACAGCTGCAGATACCTTAGTGACA
AAGTTTAATCAGCTTCCTGTTGAGGACTCTGGAAGGAAAAACTATATTTCTTTACATTCAGCCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001272069
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272069.1
RefSeq Size 2823 bp
RefSeq ORF 618 bp
Locus ID 55347
UniProt ID Q9NUJ1
MW 22.1 kDa
Gene Summary This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...