SDHD (NM_001276503) Human Untagged Clone
CAT#: SC331066
SDHD (untagged) - Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD), transcript variant 2
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CBT1; CII-4; CWS3; cybS; MC2DN3; PGL; PGL1; QPs3; SDH4 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331066 representing NM_001276503.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCGAGCTCTGTTGCTTCGAACT CCAGTGGTCAGACCTGCTCATATCTCAGCATTTCTTCAGGACCGACCTATCCCAGAATGGTGTGGAGTG CAGCACATACACTTGTCACCGAGCCACCATTGGGCCTTGGACAAGTTGTTACTGACTATGTTCATGGGG ATGCCTTGCAGAAAGCTGCCAAGGCAGGGCTTTTGGCACTTTCAGCTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276503 |
Insert Size | 258 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276503.1 |
RefSeq Size | 1250 bp |
RefSeq ORF | 258 bp |
Locus ID | 6392 |
UniProt ID | O14521 |
Protein Pathways | Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 9.7 kDa |
Gene Summary | This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013] Transcript Variant: This variant (2) lacks an alternate coding exon, which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231585 | SDHD (Myc-DDK tagged) - Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD), transcript variant 2 |
CNY 3,990.00 |
|
RG231585 | SDHD (tGFP-tagged) - Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD), transcript variant 2 |
CNY 4,370.00 |