SDHD (NM_001276506) Human Untagged Clone

CAT#: SC331068

SDHD (untagged) - Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD), transcript variant 4



  "NM_001276506" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SDHD Antibody - N-terminal region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CBT1; CII-4; CWS3; cybS; MC2DN3; PGL; PGL1; QPs3; SDH4
Vector pCMV6-Entry
Sequence Data
>SC331068 representing NM_001276506.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCGAGCTCTGTTGCTTCGAACT
CCAGTGGTCAGACCTGCTCATATCTCAGCATTTCTTCAGGACCGACCTATCCCAGAATGGTGTGGAGTG
CAGCACATACACTTGTCACCGAGCCACCATTCTGGCTCCAAGGCTGCATCTCTCCACTGGACTAGCGAG
AGGGTTGTCAGTGTTTTGCTCCTGGGTCTGCTTCCGGCTGCTTATTTGAATCCTTGCTCTGCGATGGAC
TATTCCCTGGCTGCAGCCCTCACTCTTCATGGTCACTGGCTGGAGTGCAATGGTGCGATCTTGGCTCGG
CACGATCTCGGCTCAGCACGATCTCAGCTTACTGCAACCTCCGCCTTTCGGGTTCAAGCGATTCTCCTG
CCTCAGCCTCCCAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001276506
Insert Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276506.1
RefSeq Size 1525 bp
RefSeq ORF 432 bp
Locus ID 6392
UniProt ID O14521
Protein Pathways Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 15.4 kDa
Gene Summary This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (4) contains an alternate coding exon, which results in a frameshift, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...