SLC25A22 (NM_001191060) Human Untagged Clone

CAT#: SC331149

SLC25A22 (untagged) - Homo sapiens solute carrier family 25 (mitochondrial carrier: glutamate), member 22 (SLC25A22), transcript variant 1



  "NM_001191060" in other vectors (2)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SLC25A22 Rabbit polyclonal Antibody
    • 100 ul

CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEE3; EIEE3; GC-1; GC1; NET44
Vector pCMV6-Entry
Sequence Data
>SC331149 representing NM_001191060.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGATAAGCAGATCAGCCTGCCAGCCAAGCTCATCAATGGCGGCATCGCCGGGCTGATCGGTGTC
ACCTGCGTGTTTCCCATCGACCTGGCCAAGACCAGGCTGCAGAACCAGCAGAACGGCCAGCGCGTGTAC
ACGAGCATGTCCGACTGCCTCATCAAGACCGTCCGCTCCGAGGGCTACTTCGGCATGTACCGGGGAGCT
GCTGTGAACTTGACCCTCGTCACCCCCGAGAAGGCCATCAAGCTGGCAGCCAACGACTTCTTCCGACAT
CAGCTCTCTAAGGACGGGCAGAAGCTGACCCTGCTTAAAGAGATGCTGGCGGGCTGTGGGGCTGGCACC
TGCCAGGTGATCGTGACCACGCCCATGGAGATGCTGAAGATCCAGCTGCAGGATGCAGGGCGCATTGCC
GCCCAGAGGAAGATCCTGGCTGCCCAGGGCCAGCTCTCGGCCCAGGGGGGTGCCCAGCCCTCAGTGGAG
GCTCCAGCTGCCCCTCGGCCCACGGCCACCCAGCTGACCCGCGACCTGCTGCGGAGCCGTGGCATTGCC
GGTCTCTACAAGGGACTCGGGGCCACGCTGCTCAGGGATGTCCCCTTCTCTGTGGTGTACTTCCCGCTC
TTTGCCAACCTGAACCAGCTGGGCCGCCCGGCGTCCGAGGAGAAGTCGCCTTTCTACGTGTCCTTCCTG
GCCGGCTGTGTGGCTGGGAGTGCCGCCGCTGTGGCCGTCAACCCCTGTGATGTGGTGAAGACGCGGCTC
CAGTCACTTCAGCGAGGCGTCAACGAGGACACCTACTCTGGGATCCTGGACTGTGCCAGGAAGATCCTG
CGGCACGAGGGCCCCTCGGCCTTCCTGAAGGGCGCCTACTGCCGCGCGCTGGTCATCGCGCCCCTTTTC
GGCATCGCACAGGTGGTCTACTTCCTGGGCATCGCGGAGTCCCTGCTGGGGCTGCTGCAGGACCCCCAG
GCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001191060
Insert Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001191060.1
RefSeq Size 2968 bp
RefSeq ORF 972 bp
Locus ID 79751
UniProt ID Q9H936
Protein Families Transmembrane
MW 34.5 kDa
Gene Summary This gene encodes a mitochondrial glutamate carrier. Mutations in this gene are associated with early infantile epileptic encephalopathy. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jul 2010]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...