LYPD6 (NM_001195685) Human Untagged Clone

CAT#: SC331193

LYPD6 (untagged) - Homo sapiens LY6/PLAUR domain containing 6 (LYPD6), transcript variant 1



  "NM_001195685" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-LYPD6 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331193 representing NM_001195685.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAACCTGGCCCTGCTCTGGCCTGGCTCCTGCTCCTGAGCCTGCTGGCGGATTGTCTGAAAGCTGCT
CAGTCCCGAGACTTCACAGTGAAAGACATTATCTACCTCCATCCTTCAACCACACCATATCCTGGTGGA
TTTAAATGTTTCACCTGTGAAAAGGCAGCAGACAATTATGAGTGCAACCGATGGGCTCCAGACATCTAC
TGCCCTCGAGAGACCAGATACTGCTACACTCAGCACACAATGGAAGTCACAGGAAACAGTATCTCAGTC
ACCAAACGCTGTGTCCCACTGGAAGAGTGCTTATCCACTGGCTGCAGAGACTCCGAGCATGAAGGCCAC
AAGGTCTGCACTTCTTGTTGTGAAGGAAATATCTGTAACTTGCCACTGCCCCGAAATGAAACTGATGCC
ACATTTGCCACGACGTCACCTATAAATCAGACAAATGGGCACCCACGCTGTATGTCAGTGATAGTGTCC
TGCTTGTGGTTGTGGTTAGGGCTCATGTTATAG

Restriction Sites SgfI-MluI     
ACCN NM_001195685
Insert Size 516 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001195685.1
RefSeq Size 4111 bp
RefSeq ORF 516 bp
Locus ID 130574
UniProt ID Q86Y78
Protein Families Secreted Protein
MW 19.1 kDa
Gene Summary Members of the LY6 protein family (see SLURP1; MIM 606119), such as LYPD6, have at least one 80-amino acid LU domain that contains 10 conserved cysteines with a defined disulfide-bonding pattern (Zhang et al., 2010 [PubMed 19653121]).[supplied by OMIM, Apr 2010]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...