ASCC1 (NM_001198800) Human Untagged Clone

CAT#: SC331223

ASCC1 (untagged) - Homo sapiens activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant 2



  "NM_001198800" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
ASCC1 mouse monoclonal antibody, clone OTI6G5 (formerly 6G5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASC1p50; CGI-18; p50; SMABF2
Vector pCMV6-Entry
Sequence Data
>SC331223 representing NM_001198800.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGTTCTGCGTCCACAGCTTATAAGAATTGATGGCCGGAATTACAGGAAGAATCCAGTCCAAGAA
CAGACCTATCAACATGAAGAAGATGAAGAGGACTTCTATCAAGGCTCCATGGAGTGTGCTGATGAGCCC
TGTGATGCCTACGAGGTGGAGCAGACCCCACAAGGATTCCGGTCTACTTTGAGGGCCCCCAGCTTGCTC
TATAAGCATATAGTTGGAAAGAGAGGGGACACTAGGAAGAAAATAGAAATGGAGACCAAAACTTCTATT
AGCATTCCTAAACCTGGACAAGACGGGGAAATTGTAATCACTGGCCAGCATCGAAATGGTGTAATTTCA
GCCCGAACACGGATTGATGTTCTTTTGGACACTTTTCGAAGAAAGCAGCCCTTCACTCACTTCCTTGCC
TTTTTCCTCAATGAAGTTGAGGTTCAGGAAGGATTCCTGAGATTCCAGGAGGAAGTACTGGCGAAGTGC
TCCATGGATCATGGGGTTGACAGCAGCATTTTCCAGAATCCTAAAAAGCTTCATCTAACTATTGGGATG
TTGGTGCTTTTGAGTGAGGAAGAGATCCAGCAGACATGTGAGATGCTACAGCAGTGTAAAGAGGAATTC
ATTAATGATATTTCTGGGGGTAAACCCCTAGAAGTGGAGATGGCAGGGATAGAATACATGAATGATGAT
CCTGGCATGGTGGATGTTCTTTACGCCAAAGTCCATATGAAAGATGGCTCCAACAGGCTACAAGAATTA
GTTGATCGAGTGCTGGAACGTTTTCAGGCATCTGGACTAATAGTGAAAGAGTGGAATAGTGTGAAACTG
CATGCTACAGTTATGAATACACTATTCAGGAAAGACCCCAATGCTGAAGGCAGGTACAATCTCTACACA
GCGGAAGGCAAATATATCTTCAAGGAAAGAGAATCATTTGATGGCCGAAATATTTTAAAGTTGTTTGAG
AACTTCTACTTTGGCTCCCTAAAGCTGAATTCAATTCACATCTCTCAGAGGTTCACCGTAGACAGCTTT
GGAAACTACGCTTCCTGTGGACAAATTGACTTCTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001198800
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001198800.2
RefSeq Size 2644 bp
RefSeq ORF 1074 bp
Locus ID 51008
UniProt ID Q8N9N2
MW 41.2 kDa
Gene Summary This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) lacks three exons in the coding region, which results in a translational frameshift, compared to variant 1. Variants 2 and 4 encode the same isoform (b) which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...