Angiopoietin 1 (ANGPT1) (NM_001199859) Human Untagged Clone

CAT#: SC331381

ANGPT1 (untagged) - Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 2



  "NM_001199859" in other vectors (2)

CNY 4,750.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
ANGPT1 mouse monoclonal antibody, clone OTI8H2 (formerly 8H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGP1; AGPT; ANG1; HAE5
Vector pCMV6-Entry
Sequence Data
>SC331381 representing NM_001199859.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACAGTTTTCCTTTCCTTTGCTTTCCTCGCTGCCATTCTGACTCACATAGGGTGCAGCAATCAGCGC
CGAAGTCCAGAAAACAGTGGGAGAAGATATAACCGGATTCAACATGGGCAATGTGCCTACACTTTCATT
CTTCCAGAACACGATGGCAACTGTCGTGAGAGTACGACAGACCAGTACAACACAAACGCTCTGCAGAGA
GATGCTCCACACGTGGAACCGGATTTCTCTTCCCAGAAACTTCAACATCTGGAACATGTGATGGAAAAT
TATACTCAGTGGCTGCAAAAACTTGAGAATTACATTGTGGAAAACATGAAGTCGGAGATGGCCCAGATA
CAGCAGAATGCAGTTCAGAACCACACGGCTACCATGCTGGAGATAGGAACCAGCCTCCTCTCTCAGACT
GCAGAGCAGACCAGAAAGCTGACAGATGTTGAGACCCAGGTACTAAATCAAACTTCTCGACTTGAGATA
CAGCTGCTGGAGAATTCATTATCCACCTACAAGCTAGAGAAGCAACTTCTTCAACAGACAAATGAAATC
TTGAAGATCCATGAAAAAAACAGTTTATTAGAACATAAAATCTTAGAAATGGAAGGAAAACACAAGGAA
GAGTTGGACACCTTAAAGGAAGAGAAAGAGAACCTTCAAGGCTTGGTTACTCGTCAAACATATATAATC
CAGGAGCTGGAAAAGCAATTAAACAGAGCTACCACCAACAACAGTGTCCTTCAGAAGCAGCAACTGGAG
CTGATGGACACAGTCCACAACCTTGTCAATCTTTGCACTAAAGAAGTTTTACTAAAGGGAGGAAAAAGA
GAGGAAGAGAAACCATTTAGAGACTGTGCAGATGTATATCAAGCTGGTTTTAATAAAAGTGGAATCTAC
ACTATTTATATTAATAATATGCCAGAACCCAAAAAGGTGTTTTGCAATATGGATGTCAATGGGGGAGGT
TGGACTGTAATACAACATCGTGAAGATGGAAGTCTAGATTTCCAAAGAGGCTGGAAGGAATATAAAATG
GGTTTTGGAAATCCCTCCGGTGAATATTGGCTGGGGAATGAGTTTATTTTTGCCATTACCAGTCAGAGG
CAGTACATGCTAAGAATTGAGTTAATGGACTGGGAAGGGAACCGAGCCTATTCACAGTATGACAGATTC
CACATAGGAAATGAAAAGCAAAACTATAGGTTGTATTTAAAAGGTCACACTGGGACAGCAGGAAAACAG
AGCAGCCTGATCTTACACGGTGCTGATTTCAGCACTAAAGATGCTGATAATGACAACTGTATGTGCAAA
TGTGCCCTCATGTTAACAGGAGGATGGTGGTTTGATGCTTGTGGCCCCTCCAATCTAAATGGAATGTTC
TATACTGCGGGACAAAACCATGGAAAACTGAATGGGATAAAGTGGCACTACTTCAAAGGGCCCAGTTAC
TCCTTACGTTCCACAACTATGATGATTCGACCTTTAGATTTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199859
Insert Size 1494 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199859.1
RefSeq Size 4335 bp
RefSeq ORF 1494 bp
Locus ID 284
UniProt ID Q15389
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
MW 57.5 kDa
Gene Summary This gene encodes a secreted glycoprotein that belongs to the angiopoietin family. Members of this family play important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The protein encoded by this gene is a secreted glycoprotein that activates the receptor by inducing its tyrosine phosphorylation. It plays a critical role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme and inhibits endothelial permeability. The protein also contributes to blood vessel maturation and stability, and may be involved in early development of the heart. Mutations in this gene are associated with hereditary angioedema. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, which results in an isoform (2) that is one amino acid shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...