HMGN3 (NM_001201362) Human Untagged Clone
CAT#: SC331414
HMGN3 (untagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PNAS-24; PNAS-25; TRIP7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331414 representing NM_001201362.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCGAAGAGAAAGTCTCCAGAGAATACAGAGGGCAAAGATGGATCCAAAGTAACTAAACAGGAGCCC ACAAGACGGTCTGCCAGATTGTCAGCGAAACCTGCTCCACCAAAACCTGAACCCAAACCAAGAAAAACA TCTGCTAAGAAAGAACCTGGAGCAAAGATTAGCAGAGGTGCTAAAGGGAAGAAGGAGGAAAAGCAGGAA GCTGGAAAGGAAGGTACTGCACCATCTGAAAATGGTGAAACTAAAGCTGAAGAGGTACTTTCCATAAAT ACCTCCCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201362 |
Insert Size | 288 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001201362.1 |
RefSeq Size | 1484 bp |
RefSeq ORF | 288 bp |
Locus ID | 9324 |
UniProt ID | Q15651 |
Protein Families | Druggable Genome |
MW | 10.2 kDa |
Gene Summary | The protein encoded by this gene binds thyroid hormone receptor beta in the presence of thyroid hormone. The encoded protein, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is a related pseudogene on chromosome 1. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (3) retains an alternate segment in the 3' region compared to variant 1, which results in a different 3' coding region and 3' UTR. The resulting isoform (c) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233252 | HMGN3 (Myc-DDK tagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 3 |
CNY 3,990.00 |
|
RG233252 | HMGN3 (tGFP-tagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 3 |
CNY 4,370.00 |