PLSCR3 (NM_001201576) Human Untagged Clone

CAT#: SC331445

PLSCR3 (untagged) - Homo sapiens phospholipid scramblase 3 (PLSCR3), transcript variant w



  "NM_001201576" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PLSCR3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331445 representing NM_001201576.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGGCTACTTGCCCCCCAAAGGCTACGCCCCTTCGCCCCCACCTCCCTACCCTGTCACCCCTGGG
TACCCGGAGCCGGCGCTACATCCTGGGCCCGGGCAGGCGCCAGTGCCCGCCCAGGTACCTGCCCCAGCT
CCCGGCTTCGCCCTCTTCCCCTCGCCTGGCCCCGTGGCCTTGGGGTCTGCTGCCCCCTTCTTGCCACTG
CCAGGGGTGCCTTCTGGCCTCGAATTCCTGGTGCAGATTGATCAGATTTTGATTCACCAGAAGGCTGAG
CGAGTGGAAACGTTCCTAGGCTGGGAGACCTGTAATCGGTATGAACTGCGCTCTGGGGCCGGGCAGCCC
CTGGGTCAGGCGGCCGAGGAGAGCAACTGCTGCGCCCGTCTGTGCTGTGGCGCCCGCCGGCCGCTGCGT
GTCCGCCTGGCCGACCCCGGGGACCGTGAGGTGCTGCGTTTGCTCCGCCCGCTGCACTGTGGCTGCAGC
TGCTGCCCCTGTGGCCTCCAGGAGATGGAAGTACAGGCTCCACCAGGCACCACCATTGGCCACGTGCTA
CAGACCTGGCATCCCTTCCTCCCCAAGTTCTCCATCCAGGATGCCGATCGCCAGACAGTCTTGCGAGTG
GTGGGGCCCTGCTGGACCTGTGGCTGTGGCACAGACACCAACTTTGAGGTGAAGACTCGGGATGAATCC
CGCAGTGTGGGCCGCATCAGCAAGCAGTGGGGGGGCCTGGTCCGAGAAGCCCTCACAGATGCAGATGAC
TTTGGCCTACAGTTCCCGCTGGACCTGGATGTGAGGGTGAAGGCTGTGCTGCTGGGAGCCACATTCCTC
ATTGACTACATGTTCTTTGAGAAGCGAGGAGGCGCTGGGCCCTCTGCCGTCACCAGTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001201576
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001201576.1
RefSeq Size 1981 bp
RefSeq ORF 888 bp
Locus ID 57048
UniProt ID Q9NRY6
MW 31.6 kDa
Gene Summary May mediate accelerated ATP-independent bidirectional transbilayer migration of phospholipids upon binding calcium ions that results in a loss of phospholipid asymmetry in the plasma membrane. May play a central role in the initiation of fibrin clot formation, in the activation of mast cells and in the recognition of apoptotic and injured cells by the reticuloendothelial system. Seems to play a role in apoptosis, through translocation of cardiolipin from the inner to the outer mitochondrial membrane which promotes BID recruitment and enhances tBid-induced mitochondrial damages.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...