ASB6 (NM_001202403) Human Untagged Clone

CAT#: SC331448

ASB6 (untagged) - Homo sapiens ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 3



  "NM_001202403" in other vectors (2)

CNY 3,710.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ASB6 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331448 representing NM_001202403.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCGTTCCTGCACGGCTTCCGGAGGATCATCTTCGAGTACCAGCCGCTGGTGGATGCGATTCTGGGC
TCCCTGGGGATCCAGGACCCCGAGCGGCAGGAGTCTCTGGACCGGCCCAGTTATGTCGCCAGCGAGGAG
AGCCGAATCCTTGTTCTCACTGAGCTGCTGGAGAGGAAAGCCCACTCTCCCTTTTACCAGGAAGGCGTG
AGCAACGCCCTGCTCAAGATGGCTGAGCTGGGGCTGACGCGGGCGGCCGACGTTCTCTTGCGGCATGGG
GCCAATCTCAACTTTGAAGACCCAGTCACCTACTACACGGCCTTGCACATCGCCGTCCTGCGGAACCAG
CCGGACATGGTGGAGCTGCTGGTGCATCACGGGGCCGACGTTAATCGGAGGGACCGGATCCACGAGAGT
AGCCCCTTGGACCTGGCCAGCGAGGAGCCTGAGCGCCTGCCCTGCCTGCAGCGCCTCCTGGACCTTGGA
GCTGATGTCAATGCCGCTGACAAGCATGGGGCAGACGTCAAGGCCACCACCAAAGATGGGGACACAGTG
TTCACCTGCATCATCTTCCTGCTTGGTGAGACCGTGGGAGGGGACAAAGAGGAGGCCCAGATGATCAAC
CGCTTCTGCTTCCAAGTCACACGGCTGCTGCTGGCACACGGGGCCGACCCCAGCGAGTGCCCAGCCCAC
GAGTCCCTCACCCACATCTGCCTGAAGAGCTTTAAACTGCACTTCCCTCTCCTGCGCTTCCTCCTGGAG
TCCGGAGCCGCCTACAACTGCTCCCTGCACGGTGCGTCCTGCTGGTCTGGCTTTCACATCATCTTTGAG
AGGCTCTGTTCCCACCCAGGCTGCACGGAAGACGAGAGCCATGCGGACCTCCTGCGCAAAGCTGAGACT
GTCCTGGATCTCATGGTGACCAACTCTCAGAAACTCCAGCTGCCCGAAAACTTCGATATCCACCCTGTG
GGCAGCCTGGCGGAAAAGATCCAGGCCCTCCACTTCTCCTTGAGGCAGCTGGAGAGCTATCCCCCGCCC
CTCAAGCACCTGTGCCGTGTGGCCATCCGGCTCTACCTTCAGCCGTGGCCTGTGGATGTGAAGGTCAAA
GCCCTGCCTCTGCCCGACAGGCTGAAGTGGTACCTCCTTAGCGAGCACAGTGGCTCCGTGGAAGATGAC
ATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001202403
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202403.1
RefSeq Size 4570 bp
RefSeq ORF 1179 bp
Locus ID 140459
UniProt ID Q9NWX5
Protein Families Druggable Genome
MW 44.1 kDa
Gene Summary The protein encoded by this gene belongs to a family of ankyrin repeat proteins that, along with four other protein families, contain a C-terminal SOCS box motif. Growing evidence suggests that the SOCS box, similar to the F-box, acts as a bridge between specific substrate-binding domains and the more generic proteins that comprise a large family of E3 ubiquitin protein ligases. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...