Kv1.2 (KCNA2) (NM_001204269) Human Untagged Clone

CAT#: SC331540

KCNA2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 2 (KCNA2), transcript variant 2



  "NM_001204269" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
KCNA2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEE32; EIEE32; HBK5; HK4; HUKIV; KV1.2; MK2; NGK1; RBK2
Vector pCMV6-Entry
Sequence Data
>SC331540 representing NM_001204269.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACAGTGGCCACCGGAGACCCAGCAGACGAGGCTGCTGCCCTCCCTGGGCACCCACAGGACACCTAT
GACCCAGAGGCAGACCACGAGTGCTGTGAGAGGGTGGTGATCAACATCTCAGGGCTGCGGTTTGAGACC
CAGCTAAAGACCTTAGCCCAGTTTCCAGAGACCCTCTTAGGGGACCCAAAGAAACGAATGAGGTACTTT
GACCCCCTCCGAAATGAGTACTTTTTCGATCGGAACCGCCCTAGCTTTGATGCCATTTTGTACTACTAC
CAGTCAGGGGGCCGATTGAGGCGACCTGTGAATGTGCCCTTAGATATATTCTCTGAAGAAATTCGGTTT
TATGAGCTGGGAGAAGAAGCGATGGAGATGTTTCGGGAAGATGAAGGCTACATCAAGGAGGAAGAGCGT
CCTCTGCCTGAAAATGAGTTTCAGAGACAAGTGTGGCTTCTCTTTGAATACCCAGAGAGCTCAGGGCCT
GCCAGGATTATAGCTATTGTGTCTGTCATGGTGATTCTGATCTCAATTGTCAGCTTCTGTCTGGAAACA
TTGCCCATCTTCCGGGATGAGAATGAAGACATGCATGGTAGTGGGGTGACCTTCCACACCTATTCCAAC
AGCACCATCGGGTACCAGCAGTCCACTTCCTTCACAGACCCTTTCTTCATTGTAGAGACACTCTGCATC
ATCTGGTTCTCCTTTGAATTCTTGGTGAGGTTCTTTGCCTGTCCCAGCAAAGCCGGCTTCTTCACCAAC
ATCATGAACATCATTGACATTGTGGCCATCATCCCCTACTTCATCACCCTGGGGACAGAGTTGGCTGAG
AAGCCAGAGGACGCTCAGCAAGGCCAGCAGGCCATGTCACTGGCCATCCTCCGTGTCATCCGGTTGGAA
CGCAGACCTCTGCAAAGCCAGAAGAGTAAGCGGGGAAGGCAGCATCTGAACACCTCACATGACTGCACC
TTAGGAATTAACCTAGTCGCGGGCATGACTGTACAGTGGACCAGGGCATCTGGTCCTGATGACAGGCAG
ACACCAGCTGTAACTACATTGCACAGGATGTATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204269
Insert Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204269.1
RefSeq Size 2022 bp
RefSeq ORF 1071 bp
Locus ID 3737
UniProt ID P16389
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 41 kDa
Gene Summary Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has multiple differences, compared to variant 1. These differences result in distinct 5' and 3' ends and cause translation termination at a downstream stop codon, compared to variant 1. The encoded protein (isoform b) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...