Prolactin Receptor (PRLR) (NM_001204318) Human Untagged Clone

CAT#: SC331562

PRLR (untagged) - Homo sapiens prolactin receptor (PRLR), transcript variant 5



  "NM_001204318" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Prolactin Receptor Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPRL; hPRLrI; MFAB; RI-PRLR
Vector pCMV6-Entry
Sequence Data
>SC331562 representing NM_001204318.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGGAAAATGTGGCATCTGCAACCGTTTTCACTCTGCTACTTTTTCTCAACACCTGCCTTCTGAAT
GGACAGTTACCTCCTGGAAAACCTGAGATCTTTAAATGTCGTTCTCCCAATAAGGAAACATTCACCTGC
TGGTGGAGGCCTGGGACAGATGGAGGACTTCCTACCAATTATTCACTGACTTACCACAGGGAAGGAGAG
ACACTCATGCATGAATGTCCAGACTACATAACCGGTGGCCCCAACTCCTGCCACTTTGGCAAGCAGTAC
ACCTCCATGTGGAGGACATACATCATGATGGTCAATGCCACTAACCAGATGGGAAGCAGTTTCTCGGAT
GAACTTTATGTGGACGTGACTTACATAGTTCAGCCAGACCCTCCTTTGGAGCTGGCTGTGGAAGTAAAA
CAGCCAGAAGACAGAAAACCCTACCTGTGGATTAAATGGTCTCCACCTACCCTGATTGACTTAAAAACT
GGTTGGTTCACGCTCCTGTATGAAATTCGATTAAAACCCGAGAAAGCAGCTGAGTGGGAGATCCATTTT
GCTGGGCAGCAAACAGAGTTTAAGATTCTCAGCCTACATCCAGGACAGAAATACCTTGTCCAGGTTCGC
TGCAAACCAGACCATGGATACTGGAGTGCATGGAGTCCAGCGACCTTCATTCAGATACCTAGTGGTGAC
CCCTTGATGTTGGGTGCCTCTCATTACAAAAATCTCAAATCTTACAGACCAAGAAAAATCTCAAGTCAA
GGAAGACTTGCGGTGTTCACAAAGGCAACATTGACCACAGTCCAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001204318
Insert Size 807 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204318.1
RefSeq Size 1461 bp
RefSeq ORF 807 bp
Locus ID 5618
UniProt ID P16471
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
MW 30.7 kDa
Gene Summary This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (5) is missing 3 consecutive exons, and contains an alternate 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (5, also known as delta 7/11) with a distinct C-terminus compared to isoform 1. This isoform, lacking a transmembrane domain, but containing a complete extracellular binding domain, was shown to be a secreted, prolactin-binding protein (PMID:12580759).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...