Rab2 (RAB2A) (NM_001242644) Human Untagged Clone

CAT#: SC331837

RAB2A (untagged) - Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript variant 2



  "NM_001242644" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-POLE3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LHX; RAB2
Vector pCMV6-Entry
Sequence Data
>SC331837 representing NM_001242644.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGTACGCCTATCTCTTCAAGTACATCATAATCGGCGACACAGGTGTAGAGTTCGGTGCTCGAATG
ATAACTATTGATGGGAAACAGATAAAACTTCAGATATGGGATACGGCAGGGCAAGAATCCTTTCGTTCC
ATCACAAGGTCGTATTACAGAGGTGCAGCAGGAGCTTTACTAGTTTACGATATTACACGGAGAGATACA
TTCAACCACTTGACAACCTGGTTAGAAGATGCCCGCCAGCATTCCAATTCCAACATGGTCATTATGCTT
ATTGGAAATAAAAGTGATTTAGAATCTAGAAGAGAAGTAAAAAAAGAAGAAGGTGAAGCTTTTGCACGA
GAACATGGACTCATCTTCATGGAAACGTCTGCTAAGACTGCTTCCAATGTAGAAGAGGCATTTATTAAT
ACAGCAAAAGAAATTTATGAAAAAATTCAAGAAGGAGTCTTTGACATTAATAATGAGGCAAATGGCATT
AAAATTGGCCCTCAGCATGCTGCTACCAATGCAACACATGCAGGCAATCAGGGAGGACAGCAGGCTGGG
GGCGGCTGCTGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242644
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242644.1
RefSeq Size 3740 bp
RefSeq ORF 567 bp
Locus ID 5862
UniProt ID P61019
Protein Families Druggable Genome
MW 20.8 kDa
Gene Summary The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region compared to variant 1. This results in a shorter isoform (b) missing an internal protein segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...