BRF1 (NM_001242790) Human Untagged Clone
CAT#: SC331860
BRF1 (untagged) - Homo sapiens BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit (BRF1), transcript variant 8
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRF; BRF-1; CFDS; GTF3B; hBRF; HEL-S-76p; TAF3B2; TAF3C; TAFIII90; TF3B90; TFIIIB90 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331860 representing NM_001242790.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACGGGCCGCGTGTGCCGCGGTTGCGGCGGCACGGACATCGAGCTGGACGCGGCGCGCGGGGACGCG GTGTGCACCGCCTGCGGCTCAGTGCTGGAGGACAACATCATCGTGTCCGAGGTGCAGTTCGTGGAGAGC AGCGGCGGCGGCTCCTCGGCCGTGGGCCAGTTCGTGTCCCTGGACGGTGCTGGCAAAACCCCGACTCTG GGTGGCGGCTTCCACGTGAATCTGGGGAAGGAGTCGAGAGCGCAGACCCTGCAGAATGGGAGGCGCCAC ATCCACCACCTGGGGAACCAGCTGCAGCTGAACCAGCACTGCCTGGACACCGCCTTCAACTTCTTCAAG ATGGCCGTGAGCAGGCACCTGACCCGCGGCCGGAAGATGGCCCACGTGATTGCTGCCTGCCTCTACCTG GTCTGCCGTACGGAGGGCACGCCGCACATGCTCCTGGACCTCAGCGACCTGCTCCAGGTAGACAGCCTC CGTCCTGCATCTTTCCCCACCTGGGGTTGTGACCTGGGGGTTGTGACCAGGGTTGTGACCGGGGTGTAC CCCAGGTGCCTCCACGCATCTCAGTGGCCGGTCTGTGCTGCCTGCCCAGTCAGGAAGTTTTGGTCTGTA GGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242790 |
Insert Size | 627 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242790.1 |
RefSeq Size | 1170 bp |
RefSeq ORF | 627 bp |
Locus ID | 2972 |
UniProt ID | Q92994 |
Protein Families | Transcription Factors |
MW | 22.3 kDa |
Gene Summary | This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (8) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (8) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233438 | BRF1 (Myc-DDK tagged) - Homo sapiens BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit (BRF1), transcript variant 8 |
CNY 3,990.00 |
|
RG233438 | BRF1 (tGFP-tagged) - Homo sapiens BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit (BRF1), transcript variant 8 |
CNY 4,370.00 |